ENSCSAG00000001619 (Chlorocebus sabaeus)
C2H2 ZF

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00096 (zf-C2H2) IPR007087 ENSCSAG00000001619 T090113_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
ZNF586
M08281_2.00
Homo sapiens
CCTCYRGGCCTG

CAGGCCYRGAGG
ChIP-seq
Schmitges et al.(2016)
Q9NXT0_4-7.RCADE
0.814 0.952
ZNF586
M08859_2.00
Homo sapiens
CATTTTTTCCTCCTAGGCCT

AGGCCTAGGAGGAAAAAATG
Misc
Kulakovskiy et al.(2013)
ZN586_HUMAN.H11MO.0.C
0.814 0.952
For this family, TFs with SR scores > 0.755 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
ENSCSAP00000016407 C2H2 ZF 107 129
ENSCSAP00000016407 C2H2 ZF 135 157
ENSCSAP00000016407 C2H2 ZF 163 185
ENSCSAP00000016407 C2H2 ZF 191 213
ENSCSAP00000016407 C2H2 ZF 219 241
ENSCSAP00000016407 C2H2 ZF 247 269
ENSCSAP00000016407 C2H2 ZF 274 296
ENSCSAP00000016407 C2H2 ZF 302 324
ENSCSAP00000016407 C2H2 ZF 330 352

Links

Other C2H2 ZF family TFs
Other Chlorocebus sabaeus TFs

5 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ENSGGOG00000004515 Gorilla gorilla ENSGGOG00000004515 I 0.812
ZNF586 Homo sapiens ENSG00000083828 D 0.814
ENSMMUP00000031396 Macaca fascicularis ENSMMUP00000031396 I 0.802
ZNF586 Macaca mulatta ENSMMUG00000005338 I 0.803
ZNF586 Pan troglodytes ENSPTRG00000011571 I 0.818