ZNF586 (Homo sapiens)
C2H2 ZF

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00096 (zf-C2H2) IPR007087 ENSG00000083828 T094807_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
ZNF586
M08281_2.00
Homo sapiens
CCTCYRGGCCTG

CAGGCCYRGAGG
ChIP-seq
Schmitges et al.(2016)
Q9NXT0_4-7.RCADE
(Direct) (Direct)
ZNF586
M08859_2.00
Homo sapiens
CATTTTTTCCTCCTAGGCCT

AGGCCTAGGAGGAAAAAATG
Misc
Kulakovskiy et al.(2013)
ZN586_HUMAN.H11MO.0.C
(Direct) (Direct)

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
For this family, TFs with SR scores > 0.755 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
ENSP00000375583 C2H2 ZF 107 124
ENSP00000375583 C2H2 ZF 135 157
ENSP00000375583 C2H2 ZF 163 185
ENSP00000375583 C2H2 ZF 191 213
ENSP00000375583 C2H2 ZF 219 241
ENSP00000375583 C2H2 ZF 247 269
ENSP00000375583 C2H2 ZF 274 296
ENSP00000375583 C2H2 ZF 302 324
ENSP00000375583 C2H2 ZF 330 352
ENSP00000379458 C2H2 ZF 150 167
ENSP00000379458 C2H2 ZF 178 200
ENSP00000379458 C2H2 ZF 206 228
ENSP00000379458 C2H2 ZF 234 256
ENSP00000379458 C2H2 ZF 262 284
ENSP00000379458 C2H2 ZF 290 312
ENSP00000379458 C2H2 ZF 317 339
ENSP00000379458 C2H2 ZF 345 367
ENSP00000379458 C2H2 ZF 373 395

Links

Other C2H2 ZF family TFs
Other Homo sapiens TFs

6 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ENSGGOG00000004515 Gorilla gorilla ENSGGOG00000004515 I 0.826
ZNF586 Pan troglodytes ENSPTRG00000011571 I 0.823
ENSCSAG00000001619 Chlorocebus sabaeus ENSCSAG00000001619 I 0.814
ENSMMUP00000031396 Macaca fascicularis ENSMMUP00000031396 I 0.789
ZNF586 Macaca mulatta ENSMMUG00000005338 I 0.789