Bo5g133380 (Brassica oleracea)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 Bo5g133380 T267393_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.849 0.979
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.841 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.841 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.831 0.936
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Bo5g133380.1 Myb 503 553

Links

Other Myb/SANT family TFs
Other Brassica oleracea TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AB10294.1 Alternaria brassicicola AB10294.1 I 0.000
AOL_s00006g157 Arthrobotrys oligospora AOL_s00006g157 I 0.000
Bcin11g00730 Botrytis cinerea Bcin11g00730 I 0.000
BGHDH14_bgh03873 Blumeria graminis BGHDH14_bgh03873 I 0.000
COCC4DRAFT_20732 Bipolaris maydis COCC4DRAFT_20732 I 0.000
COCCADRAFT_39951 Bipolaris zeicola COCCADRAFT_39951 I 0.000
COCMIDRAFT_35015 Bipolaris oryzae COCMIDRAFT_35015 I 0.000
COCSADRAFT_103706 Bipolaris sorokiniana COCSADRAFT_103706 I 0.000
COCVIDRAFT_32043 Bipolaris victoriae COCVIDRAFT_32043 I 0.000
CTHT_0009920 Chaetomium thermophilum CTHT_0009920 I 0.000
DRE_02170 Drechslerella stenobrocha DRE_02170 I 0.000
estExt_fgenesh1_pg.C_60367 Cochliobolus heterostrophus C5 estExt_fgenesh1_pg.C_60367 I 0.000
estExt_Genewise1.C_21713 Neurospora discreta estExt_Genewise1.C_21713 I 0.000
EV44_g5959 Erysiphe necator EV44_g5959 I 0.000
fgenesh1_pg.sca_1_chr1_3_0000074 Nectria haematococca fgenesh1_pg.sca_1_chr1_3_0000074 I 0.000
H072_5364 Dactylellina haptotyla H072_5364 I 0.000
M7I_1571 Glarea lozoyensis M7I_1571 I 0.000
MAC_07140 Metarhizium acridum MAC_07140 I 0.000
MAJ_04550 Metarhizium majus MAJ_04550 I 0.000
MANI_013624 Metarhizium anisopliae MANI_013624 I 0.000
MBM_05926 Marssonina brunnea MBM_05926 I 0.000
MBR_06038 Metarhizium brunneum MBR_06038 I 0.000
MGU_06439 Metarhizium guizhouense MGU_06439 I 0.000
NCU02724 Neurospora crassa NCU02724 D 0.000
NechaG74463 Fusarium solani NechaG74463 I 0.000
NEUTE1DRAFT_126349 Neurospora tetrasperma NEUTE1DRAFT_126349 I 0.000
OIDMADRAFT_121959 Oidiodendron maius OIDMADRAFT_121959 I 0.000
PTRG_11389 Pyrenophora triticirepentis PTRG_11389 I 0.000
PTT_08645 Pyrenophora teres PTT_08645 I 0.000
S40285_05978 Stachybotrys chlorohalonata S40285_05978 I 0.000
S40288_06808 Stachybotrys chartarum S40288_06808 I 0.000
SBOR_9785 Sclerotinia borealis SBOR_9785 I 0.000
SETTUDRAFT_141598 Setosphaeria turcica SETTUDRAFT_141598 I 0.000
SMAC_04294 Sordaria macrospora SMAC_04294 I 0.000
SS1G_14446 Sclerotinia sclerotiorum SS1G_14446 I 0.000
UV8b_2201 Ustilaginoidea virens UV8b_2201 I 0.000
X797_005794 Metarhizium robertsii X797_005794 I 0.000