TBP1 (Arabidopsis lyrata)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 fgenesh2_kg.6__1339__AT5G13820.1 T270811_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.839 0.915
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.839 0.894
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.831 0.894
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.831 0.894
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.821 0.872
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
fgenesh2_kg.6__1339__AT5G13820.1 Myb 541 591

Links

Other Myb/SANT family TFs
Other Arabidopsis lyrata TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
28154.m000040 Ricinus communis 28154.m000040 I 0.000
29602.m000218 Ricinus communis 29602.m000218 I 0.000
30147.m013885 Ricinus communis 30147.m013885 I 0.000
30190.m011268 Ricinus communis 30190.m011268 I 0.000
AMTR_s00001p00105570 Amborella trichopoda AMTR_s00001p00105570 I 0.000
AMTR_s00005p00268890 Amborella trichopoda AMTR_s00005p00268890 I 0.000
AMTR_s00022p00252530 Amborella trichopoda AMTR_s00022p00252530 I 0.000
AMTR_s00032p00221670 Amborella trichopoda AMTR_s00032p00221670 I 0.000
AMTR_s00045p00146180 Amborella trichopoda AMTR_s00045p00146180 I 0.000
AMTR_s00079p00143780 Amborella trichopoda AMTR_s00079p00143780 I 0.000
AMTR_s00139p00079430 Amborella trichopoda AMTR_s00139p00079430 I 0.000
Aquca_003_00245 Aquilegia coerulea Aquca_003_00245 I 0.000
Aquca_011_00538 Aquilegia coerulea Aquca_011_00538 I 0.000
Aquca_013_00221 Aquilegia coerulea Aquca_013_00221 I 0.000
Aquca_014_00829 Aquilegia coerulea Aquca_014_00829 I 0.000
Aquca_020_00444 Aquilegia coerulea Aquca_020_00444 I 0.000
MYB61 Arabidopsis thaliana AT1G09540 D 0.000
MYB3 Arabidopsis thaliana AT1G22640 D 0.000
AtMYB50 Arabidopsis thaliana AT1G57560 I 0.000
AtMYB103 Arabidopsis thaliana AT1G63910 I 0.000
MYB7 Arabidopsis thaliana AT2G16720 I 0.000
MYB83 Arabidopsis thaliana AT3G08500 D 0.000
MYB26 Arabidopsis thaliana AT3G13890 I 0.000
MYB55 Arabidopsis thaliana AT4G01680 D 0.000
MYB32 Arabidopsis thaliana AT4G34990 I 0.000
MYB4 Arabidopsis thaliana AT4G38620 D 0.000
MYB46 Arabidopsis thaliana AT5G12870 D 0.000
MYB86 Arabidopsis thaliana AT5G26660 I 0.000
BGIOSGA001460 Oryza indica BGIOSGA001460 I 0.000
BGIOSGA001461 Oryza indica BGIOSGA001461 I 0.000
BGIOSGA001872 Oryza indica BGIOSGA001872 I 0.000
BGIOSGA004306 Oryza indica BGIOSGA004306 I 0.000
BGIOSGA010658 Oryza indica BGIOSGA010658 I 0.000
BGIOSGA019160 Oryza indica BGIOSGA019160 I 0.000
BGIOSGA020297 Oryza indica BGIOSGA020297 I 0.000
BGIOSGA026208 Oryza indica BGIOSGA026208 I 0.000
BGIOSGA027659 Oryza indica BGIOSGA027659 I 0.000
BGIOSGA029363 Oryza indica BGIOSGA029363 I 0.000
BGIOSGA034924 Oryza indica BGIOSGA034924 I 0.000
BGIOSGA036092 Oryza indica BGIOSGA036092 I 0.000
Bo1g134790 Brassica oleracea Bo1g134790 I 0.000
Bo2g010970 Brassica oleracea Bo2g010970 I 0.000
Bo2g156300 Brassica oleracea Bo2g156300 I 0.000
Bo3g008870 Brassica oleracea Bo3g008870 I 0.000
Bo3g061630 Brassica oleracea Bo3g061630 I 0.000
Bo3g149450 Brassica oleracea Bo3g149450 I 0.000
Bo5g009920 Brassica oleracea Bo5g009920 I 0.000
Bo5g038720 Brassica oleracea Bo5g038720 I 0.000
Bo5g139830 Brassica oleracea Bo5g139830 I 0.000
Bo7g057770 Brassica oleracea Bo7g057770 I 0.000
Bo7g095130 Brassica oleracea Bo7g095130 I 0.000
Bo7g117140 Brassica oleracea Bo7g117140 I 0.000
Bo7g119670 Brassica oleracea Bo7g119670 I 0.000
Bo8g071580 Brassica oleracea Bo8g071580 I 0.000
Bo8g111090 Brassica oleracea Bo8g111090 I 0.000
Bo9g004210 Brassica oleracea Bo9g004210 I 0.000
Bo9g010860 Brassica oleracea Bo9g010860 I 0.000
Bo9g029530 Brassica oleracea Bo9g029530 I 0.000
Bo9g033970 Brassica oleracea Bo9g033970 I 0.000
Bo9g169270 Brassica oleracea Bo9g169270 I 0.000
Bostr.12659s0116 Boechera stricta Bostr.12659s0116 I 0.000
Bostr.18351s0132 Boechera stricta Bostr.18351s0132 I 0.000
Bostr.22252s0219 Boechera stricta Bostr.22252s0219 I 0.000
Bostr.25494s0012 Boechera stricta Bostr.25494s0012 I 0.000
Bostr.25542s0045 Boechera stricta Bostr.25542s0045 I 0.000
Bostr.28625s0318 Boechera stricta Bostr.28625s0318 I 0.000
Bostr.2902s0023 Boechera stricta Bostr.2902s0023 I 0.000
Bostr.29223s0142 Boechera stricta Bostr.29223s0142 I 0.000
Bostr.29827s0161 Boechera stricta Bostr.29827s0161 I 0.000
Bostr.30057s0004 Boechera stricta Bostr.30057s0004 I 0.000
Bostr.4825s0008 Boechera stricta Bostr.4825s0008 I 0.000
Bostr.7867s1358 Boechera stricta Bostr.7867s1358 I 0.000
Bra001284 Brassica rapa Bra001284 I 0.000
Bra006166 Brassica rapa Bra006166 I 0.000
Bra008875 Brassica rapa Bra008875 I 0.000
Bra010736 Brassica rapa Bra010736 I 0.000
Bra011576 Brassica rapa Bra011576 I 0.000
Bra012337 Brassica rapa Bra012337 I 0.000
Bra017685 Brassica rapa Bra017685 I 0.000
Bra020016 Brassica rapa Bra020016 I 0.000
Bra020526 Brassica rapa Bra020526 I 0.000
Bra021515 Brassica rapa Bra021515 I 0.000
Bra024526 Brassica rapa Bra024526 I 0.000
Bra027668 Brassica rapa Bra027668 I 0.000
Bra027771 Brassica rapa Bra027771 I 0.000
Bra029696 Brassica rapa Bra029696 I 0.000
Bra030783 Brassica rapa Bra030783 I 0.000
Bra031669 Brassica rapa Bra031669 I 0.000
Bra033572 Brassica rapa Bra033572 I 0.000
Bra036317 Brassica rapa Bra036317 I 0.000
Bra036588 Brassica rapa Bra036588 I 0.000
BRADI1G20250 Brachypodium distachyon BRADI1G20250 I 0.000
BRADI1G26920 Brachypodium distachyon BRADI1G26920 I 0.000
BRADI2G11080 Brachypodium distachyon BRADI2G11080 I 0.000
BRADI2G17982 Brachypodium distachyon BRADI2G17982 I 0.000
BRADI2G36730 Brachypodium distachyon BRADI2G36730 I 0.000
BRADI2G40620 Brachypodium distachyon BRADI2G40620 I 0.000
BRADI2G47887 Brachypodium distachyon BRADI2G47887 I 0.000
BRADI3G17165 Brachypodium distachyon BRADI3G17165 I 0.000
BRADI4G06317 Brachypodium distachyon BRADI4G06317 I 0.000
BRADI4G23967 Brachypodium distachyon BRADI4G23967 I 0.000
BRADI4G36460 Brachypodium distachyon BRADI4G36460 I 0.000
Cagra.0114s0040 Capsella grandiflora Cagra.0114s0040 I 0.000
Cagra.0334s0011 Capsella grandiflora Cagra.0334s0011 I 0.000
Cagra.0736s0026 Capsella grandiflora Cagra.0736s0026 I 0.000
Cagra.10702s0006 Capsella grandiflora Cagra.10702s0006 I 0.000
Cagra.1383s0046 Capsella grandiflora Cagra.1383s0046 I 0.000
Cagra.1533s0005 Capsella grandiflora Cagra.1533s0005 I 0.000
Cagra.1535s0018 Capsella grandiflora Cagra.1535s0018 I 0.000
Cagra.23492s0001 Capsella grandiflora Cagra.23492s0001 I 0.000
Cagra.2350s0045 Capsella grandiflora Cagra.2350s0045 I 0.000
Cagra.2991s0041 Capsella grandiflora Cagra.2991s0041 I 0.000
Cagra.4395s0139 Capsella grandiflora Cagra.4395s0139 I 0.000
Cagra.6972s0001 Capsella grandiflora Cagra.6972s0001 I 0.000
Carubv10001224m.g Capsella rubella Carubv10001224m.g I 0.000
Carubv10001308m.g Capsella rubella Carubv10001308m.g I 0.000
Carubv10001573m.g Capsella rubella Carubv10001573m.g I 0.000
Carubv10005426m.g Capsella rubella Carubv10005426m.g I 0.000
Carubv10005438m.g Capsella rubella Carubv10005438m.g I 0.000
Carubv10009497m.g Capsella rubella Carubv10009497m.g I 0.000
Carubv10009761m.g Capsella rubella Carubv10009761m.g I 0.000
Carubv10014093m.g Capsella rubella Carubv10014093m.g I 0.000
Carubv10014371m.g Capsella rubella Carubv10014371m.g I 0.000
Carubv10015767m.g Capsella rubella Carubv10015767m.g I 0.000
Carubv10020714m.g Capsella rubella Carubv10020714m.g I 0.000
Carubv10021858m.g Capsella rubella Carubv10021858m.g I 0.000
cassava12868.valid.m1 Manihot esculenta cassava12868.valid.m1 I 0.000
cassava16245.m1 Manihot esculenta cassava16245.m1 I 0.000
cassava1644.valid.m1 Manihot esculenta cassava1644.valid.m1 I 0.000
cassava176.valid.m1 Manihot esculenta cassava176.valid.m1 I 0.000
cassava17679.valid.m1 Manihot esculenta cassava17679.valid.m1 I 0.000
cassava19716.m1 Manihot esculenta cassava19716.m1 I 0.000
cassava21326.m1 Manihot esculenta cassava21326.m1 I 0.000
cassava2597.m1 Manihot esculenta cassava2597.m1 I 0.000
cassava26284.m1 Manihot esculenta cassava26284.m1 I 0.000
cassava29150.valid.m1 Manihot esculenta cassava29150.valid.m1 I 0.000
cassava30431.valid.m1 Manihot esculenta cassava30431.valid.m1 I 0.000
cassava30676.valid.m1 Manihot esculenta cassava30676.valid.m1 I 0.000
cassava32908.m1 Manihot esculenta cassava32908.m1 I 0.000
cassava33008.m1 Manihot esculenta cassava33008.m1 I 0.000
cassava33475.m1 Manihot esculenta cassava33475.m1 I 0.000
cassava33965.m1 Manihot esculenta cassava33965.m1 I 0.000
cassava34928.m1 Manihot esculenta cassava34928.m1 I 0.000
cassava35464.valid.m1 Manihot esculenta cassava35464.valid.m1 I 0.000
cassava39324.m1 Manihot esculenta cassava39324.m1 I 0.000
cassava39861.m1 Manihot esculenta cassava39861.m1 I 0.000
cassava4975.m1 Manihot esculenta cassava4975.m1 I 0.000
cassava5203.m1 Manihot esculenta cassava5203.m1 I 0.000
cassava6228.valid.m1 Manihot esculenta cassava6228.valid.m1 I 0.000
Ca_01055 Cicer arietinum Ca_01055 I 0.000
Ca_01072 Cicer arietinum Ca_01072 I 0.000
Ca_02730 Cicer arietinum Ca_02730 I 0.000
Ca_03564 Cicer arietinum Ca_03564 I 0.000
Ca_03589 Cicer arietinum Ca_03589 I 0.000
Ca_05777 Cicer arietinum Ca_05777 I 0.000
Ca_07460 Cicer arietinum Ca_07460 I 0.000
Ca_10069 Cicer arietinum Ca_10069 I 0.000
Ca_11026 Cicer arietinum Ca_11026 I 0.000
Ca_16131 Cicer arietinum Ca_16131 I 0.000
Ca_16913 Cicer arietinum Ca_16913 I 0.000
Ca_19758 Cicer arietinum Ca_19758 I 0.000
chr1.CM0122.20.nc Lotus japonicus chr1.CM0122.20.nc I 0.000
chr1.CM0206.990.nd Lotus japonicus chr1.CM0206.990.nd I 0.000
chr4.CM0172.120.nc Lotus japonicus chr4.CM0172.120.nc I 0.000
chr5.CM0048.130.nc Lotus japonicus chr5.CM0048.130.nc I 0.000
chr5.CM0048.320.nd Lotus japonicus chr5.CM0048.320.nd I 0.000
chr5.CM0148.380.nc Lotus japonicus chr5.CM0148.380.nc I 0.000
Ciclev10002068m.g Citrus clementina Ciclev10002068m.g I 0.000
Ciclev10017654m.g Citrus clementina Ciclev10017654m.g I 0.000
Ciclev10020144m.g Citrus clementina Ciclev10020144m.g I 0.000
Ciclev10021161m.g Citrus clementina Ciclev10021161m.g I 0.000
Ciclev10024338m.g Citrus clementina Ciclev10024338m.g I 0.000
Ciclev10027201m.g Citrus clementina Ciclev10027201m.g I 0.000
Ciclev10028908m.g Citrus clementina Ciclev10028908m.g I 0.000
Ciclev10033941m.g Citrus clementina Ciclev10033941m.g I 0.000
Cla003497 Citrullus lanatus Cla003497 I 0.000
Cla005219 Citrullus lanatus Cla005219 I 0.000
Cla008683 Citrullus lanatus Cla008683 I 0.000
Cla011601 Citrullus lanatus Cla011601 I 0.000
Cla012721 Citrullus lanatus Cla012721 I 0.000
Cla012793 Citrullus lanatus Cla012793 I 0.000
Cla016084 Citrullus lanatus Cla016084 I 0.000
Cla017541 Citrullus lanatus Cla017541 I 0.000
Cla019513 Citrullus lanatus Cla019513 I 0.000
Cla020303 Citrullus lanatus Cla020303 I 0.000
Cla020592 Citrullus lanatus Cla020592 I 0.000
Cucsa.051050 Cucumis sativus Cucsa.051050 I 0.000
Cucsa.061660 Cucumis sativus Cucsa.061660 I 0.000
Cucsa.065530 Cucumis sativus Cucsa.065530 I 0.000
Cucsa.090310 Cucumis sativus Cucsa.090310 I 0.000
Cucsa.098700 Cucumis sativus Cucsa.098700 I 0.000
Cucsa.127860 Cucumis sativus Cucsa.127860 I 0.000
Cucsa.195180 Cucumis sativus Cucsa.195180 I 0.000
Cucsa.196550 Cucumis sativus Cucsa.196550 I 0.000
Cucsa.234310 Cucumis sativus Cucsa.234310 I 0.000
Cucsa.303440 Cucumis sativus Cucsa.303440 I 0.000
Cucsa.340960 Cucumis sativus Cucsa.340960 I 0.000
Cucsa.370600 Cucumis sativus Cucsa.370600 I 0.000
Eucgr.A00996 Eucalyptus grandis Eucgr.A00996 I 0.000
Eucgr.A02796 Eucalyptus grandis Eucgr.A02796 I 0.000
Eucgr.B00229 Eucalyptus grandis Eucgr.B00229 I 0.000
Eucgr.B00865 Eucalyptus grandis Eucgr.B00865 I 0.000
Eucgr.B01827 Eucalyptus grandis Eucgr.B01827 I 0.000
Eucgr.B02197 Eucalyptus grandis Eucgr.B02197 I 0.000
Eucgr.B02896 Eucalyptus grandis Eucgr.B02896 I 0.000
Eucgr.B03684 Eucalyptus grandis Eucgr.B03684 I 0.000
Eucgr.D01819 Eucalyptus grandis Eucgr.D01819 I 0.000
Eucgr.F02583 Eucalyptus grandis Eucgr.F02583 I 0.000
Eucgr.F03143 Eucalyptus grandis Eucgr.F03143 I 0.000
Eucgr.G01774 Eucalyptus grandis Eucgr.G01774 I 0.000
Eucgr.G03385 Eucalyptus grandis Eucgr.G03385 I 0.000
Eucgr.H01337 Eucalyptus grandis Eucgr.H01337 I 0.000
Eucgr.I00012 Eucalyptus grandis Eucgr.I00012 I 0.000
Eucgr.I01406 Eucalyptus grandis Eucgr.I01406 I 0.000
Eucgr.K00250 Eucalyptus grandis Eucgr.K00250 I 0.000
Eucgr.K00555 Eucalyptus grandis Eucgr.K00555 I 0.000
Eucgr.K02806 Eucalyptus grandis Eucgr.K02806 I 0.000
evm.TU.supercontig_107.47 Carica papaya evm.TU.supercontig_107.47 I 0.000
evm.TU.supercontig_110.11 Carica papaya evm.TU.supercontig_110.11 I 0.000
evm.TU.supercontig_214.5 Carica papaya evm.TU.supercontig_214.5 I 0.000
evm.TU.supercontig_25.69 Carica papaya evm.TU.supercontig_25.69 I 0.000
evm.TU.supercontig_37.149 Carica papaya evm.TU.supercontig_37.149 I 0.000
evm.TU.supercontig_57.32 Carica papaya evm.TU.supercontig_57.32 I 0.000
evm.TU.supercontig_6.280 Carica papaya evm.TU.supercontig_6.280 I 0.000
evm.TU.supercontig_640.1 Carica papaya evm.TU.supercontig_640.1 I 0.000
evm.TU.supercontig_84.59 Carica papaya evm.TU.supercontig_84.59 I 0.000
e_gw1.211.99.1 Physcomitrella patens e_gw1.211.99.1 I 0.000
e_gw1.24.66.1 Physcomitrella patens e_gw1.24.66.1 I 0.000
F775_01821 Aegilops tauschii F775_01821 I 0.000
F775_06561 Aegilops tauschii F775_06561 I 0.000
F775_17110 Aegilops tauschii F775_17110 I 0.000
F775_28584 Aegilops tauschii F775_28584 I 0.000
F775_28951 Aegilops tauschii F775_28951 I 0.000
F775_31191 Aegilops tauschii F775_31191 I 0.000
fgenesh1_pg.scaffold_189000016 Physcomitrella patens fgenesh1_pg.scaffold_189000016 I 0.000
AtMYB50 Arabidopsis lyrata fgenesh1_pm.C_scaffold_1003728 I 0.000
AtMYB103 Arabidopsis lyrata fgenesh1_pm.C_scaffold_2000072 I 0.000
ATMYB3 Arabidopsis lyrata fgenesh2_kg.1__2457__AT1G22640.1 I 0.000
MYB26 Arabidopsis lyrata fgenesh2_kg.3__1496__AT3G13890.1 I 0.000
MYB83 Arabidopsis lyrata fgenesh2_kg.3__848__AT3G08500.1 I 0.000
ATMYB86 Arabidopsis lyrata fgenesh2_kg.6__2630__AT5G26660.1 I 0.000
MYB55 Arabidopsis lyrata fgenesh2_kg.6__3543__AT4G01680.1 I 0.000
ATMYB4 Arabidopsis lyrata fgenesh2_kg.7__59__AT4G38620.1 I 0.000
gene06920-v1.0-hybrid Fragaria vesca gene06920-v1.0-hybrid I 0.000
gene07646-v1.0-hybrid Fragaria vesca gene07646-v1.0-hybrid I 0.000
gene09407-v1.0-hybrid Fragaria vesca gene09407-v1.0-hybrid I 0.000
gene09845-v1.0-hybrid Fragaria vesca gene09845-v1.0-hybrid I 0.000
gene13281-v1.0-hybrid Fragaria vesca gene13281-v1.0-hybrid I 0.000
gene14666-v1.0-hybrid Fragaria vesca gene14666-v1.0-hybrid I 0.000
gene22961-v1.0-hybrid Fragaria vesca gene22961-v1.0-hybrid I 0.000
gene25685-v1.0-hybrid Fragaria vesca gene25685-v1.0-hybrid I 0.000
gene27001-v1.0-hybrid Fragaria vesca gene27001-v1.0-hybrid I 0.000
gene31835-v1.0-hybrid Fragaria vesca gene31835-v1.0-hybrid I 0.000
gene31836-v1.0-hybrid Fragaria vesca gene31836-v1.0-hybrid I 0.000
GLYMA01G43120 Glycine max GLYMA01G43120 I 0.000
GLYMA02G00960 Glycine max GLYMA02G00960 I 0.000
GLYMA02G41440 Glycine max GLYMA02G41440 I 0.000
GLYMA03G38410 Glycine max GLYMA03G38410 I 0.000
GLYMA03G38660 Glycine max GLYMA03G38660 I 0.000
GLYMA04G36110 Glycine max GLYMA04G36110 I 0.000
GLYMA04G38240 Glycine max GLYMA04G38240 I 0.000
GLYMA05G02550 Glycine max GLYMA05G02550 I 0.000
GLYMA05G37460 Glycine max GLYMA05G37460 I 0.000
GLYMA06G16820 Glycine max GLYMA06G16820 I 0.000
GLYMA06G18830 Glycine max GLYMA06G18830 I 0.000
GLYMA07G01050 Glycine max GLYMA07G01050 I 0.000
GLYMA07G33960 Glycine max GLYMA07G33960 I 0.000
GLYMA08G02080 Glycine max GLYMA08G02080 I 0.000
GLYMA08G20440 Glycine max GLYMA08G20440 I 0.000
GLYMA10G27940 Glycine max GLYMA10G27940 I 0.000
GLYMA10G28250 Glycine max GLYMA10G28250 I 0.000
GLYMA11G02400 Glycine max GLYMA11G02400 I 0.000
GLYMA11G11450 Glycine max GLYMA11G11450 I 0.000
GLYMA11G14200 Glycine max GLYMA11G14200 I 0.000
GLYMA12G03600 Glycine max GLYMA12G03600 I 0.000
GLYMA12G06180 Glycine max GLYMA12G06180 I 0.000
GLYMA12G36630 Glycine max GLYMA12G36630 I 0.000
GLYMA13G07020 Glycine max GLYMA13G07020 I 0.000
GLYMA13G27310 Glycine max GLYMA13G27310 I 0.000
GLYMA13G41470 Glycine max GLYMA13G41470 I 0.000
GLYMA13G42431 Glycine max GLYMA13G42431 I 0.000
GLYMA15G02955 Glycine max GLYMA15G02955 I 0.000
GLYMA15G03920 Glycine max GLYMA15G03920 I 0.000
GLYMA17G09310 Glycine max GLYMA17G09310 I 0.000
GLYMA19G05080 Glycine max GLYMA19G05080 I 0.000
GLYMA19G41010 Glycine max GLYMA19G41010 I 0.000
GLYMA19G41250 Glycine max GLYMA19G41250 I 0.000
GLYMA20G01610 Glycine max GLYMA20G01610 I 0.000
GLYMA20G22230 Glycine max GLYMA20G22230 I 0.000
Gorai.001G138800 Gossypium raimondii Gorai.001G138800 I 0.000
Gorai.001G148500 Gossypium raimondii Gorai.001G148500 I 0.000
Gorai.002G180300 Gossypium raimondii Gorai.002G180300 I 0.000
Gorai.002G196700 Gossypium raimondii Gorai.002G196700 I 0.000
Gorai.003G155400 Gossypium raimondii Gorai.003G155400 I 0.000
Gorai.004G037300 Gossypium raimondii Gorai.004G037300 I 0.000
Gorai.004G138300 Gossypium raimondii Gorai.004G138300 I 0.000
Gorai.004G147600 Gossypium raimondii Gorai.004G147600 I 0.000
Gorai.004G172700 Gossypium raimondii Gorai.004G172700 I 0.000
Gorai.005G162600 Gossypium raimondii Gorai.005G162600 I 0.000
Gorai.005G254000 Gossypium raimondii Gorai.005G254000 I 0.000
Gorai.006G129100 Gossypium raimondii Gorai.006G129100 I 0.000
Gorai.007G011100 Gossypium raimondii Gorai.007G011100 I 0.000
Gorai.007G118200 Gossypium raimondii Gorai.007G118200 I 0.000
Gorai.007G179300 Gossypium raimondii Gorai.007G179300 I 0.000
Gorai.007G192900 Gossypium raimondii Gorai.007G192900 I 0.000
Gorai.008G035700 Gossypium raimondii Gorai.008G035700 I 0.000
Gorai.008G133700 Gossypium raimondii Gorai.008G133700 I 0.000
Gorai.008G277900 Gossypium raimondii Gorai.008G277900 I 0.000
Gorai.009G142200 Gossypium raimondii Gorai.009G142200 I 0.000
Gorai.009G288900 Gossypium raimondii Gorai.009G288900 I 0.000
Gorai.011G063900 Gossypium raimondii Gorai.011G063900 I 0.000
Gorai.013G139200 Gossypium raimondii Gorai.013G139200 I 0.000
Gorai.013G251100 Gossypium raimondii Gorai.013G251100 I 0.000
GRMZM2G000818 Zea mays GRMZM2G000818 I 0.000
GRMZM2G017520 Zea mays GRMZM2G017520 I 0.000
GRMZM2G031323 Zea mays GRMZM2G031323 I 0.000
GRMZM2G052606 Zea mays GRMZM2G052606 I 0.000
GRMZM2G064744 Zea mays GRMZM2G064744 I 0.000
GRMZM2G088783 Zea mays GRMZM2G088783 I 0.000
GRMZM2G127490 Zea mays GRMZM2G127490 I 0.000
GRMZM2G147698 Zea mays GRMZM2G147698 I 0.000
GRMZM2G150841 Zea mays GRMZM2G150841 I 0.000
GRMZM2G166337 Zea mays GRMZM2G166337 I 0.000
GRMZM2G171781 Zea mays GRMZM2G171781 I 0.000
GRMZM2G175232 Zea mays GRMZM2G175232 I 0.000
GRMZM2G325907 Zea mays GRMZM2G325907 I 0.000
GSMUA_Achr10G04590_001 Musa acuminata GSMUA_Achr10G04590_001 I 0.000
GSMUA_Achr10G08070_001 Musa acuminata GSMUA_Achr10G08070_001 I 0.000
GSMUA_Achr10G16010_001 Musa acuminata GSMUA_Achr10G16010_001 I 0.000
GSMUA_Achr10G19970_001 Musa acuminata GSMUA_Achr10G19970_001 I 0.000
GSMUA_Achr11G00430_001 Musa acuminata GSMUA_Achr11G00430_001 I 0.000
GSMUA_Achr11G15910_001 Musa acuminata GSMUA_Achr11G15910_001 I 0.000
GSMUA_Achr1G18990_001 Musa acuminata GSMUA_Achr1G18990_001 I 0.000
GSMUA_Achr1G23990_001 Musa acuminata GSMUA_Achr1G23990_001 I 0.000
GSMUA_Achr1G25120_001 Musa acuminata GSMUA_Achr1G25120_001 I 0.000
GSMUA_Achr1G26520_001 Musa acuminata GSMUA_Achr1G26520_001 I 0.000
GSMUA_Achr2G01830_001 Musa acuminata GSMUA_Achr2G01830_001 I 0.000
GSMUA_Achr2G07780_001 Musa acuminata GSMUA_Achr2G07780_001 I 0.000
GSMUA_Achr2G07930_001 Musa acuminata GSMUA_Achr2G07930_001 I 0.000
GSMUA_Achr2G18440_001 Musa acuminata GSMUA_Achr2G18440_001 I 0.000
GSMUA_Achr2G20600_001 Musa acuminata GSMUA_Achr2G20600_001 I 0.000
GSMUA_Achr3G12200_001 Musa acuminata GSMUA_Achr3G12200_001 I 0.000
GSMUA_Achr3G21000_001 Musa acuminata GSMUA_Achr3G21000_001 I 0.000
GSMUA_Achr3G24580_001 Musa acuminata GSMUA_Achr3G24580_001 I 0.000
GSMUA_Achr4G19560_001 Musa acuminata GSMUA_Achr4G19560_001 I 0.000
GSMUA_Achr5G17010_001 Musa acuminata GSMUA_Achr5G17010_001 I 0.000
GSMUA_Achr5G18400_001 Musa acuminata GSMUA_Achr5G18400_001 I 0.000
GSMUA_Achr6G07260_001 Musa acuminata GSMUA_Achr6G07260_001 I 0.000
GSMUA_Achr6G12930_001 Musa acuminata GSMUA_Achr6G12930_001 I 0.000
GSMUA_Achr6G25420_001 Musa acuminata GSMUA_Achr6G25420_001 I 0.000
GSMUA_Achr6G29310_001 Musa acuminata GSMUA_Achr6G29310_001 I 0.000
GSMUA_Achr6G35800_001 Musa acuminata GSMUA_Achr6G35800_001 I 0.000
GSMUA_Achr6G36930_001 Musa acuminata GSMUA_Achr6G36930_001 I 0.000
GSMUA_Achr7G17250_001 Musa acuminata GSMUA_Achr7G17250_001 I 0.000
GSMUA_Achr8G11340_001 Musa acuminata GSMUA_Achr8G11340_001 I 0.000
GSMUA_Achr8G18730_001 Musa acuminata GSMUA_Achr8G18730_001 I 0.000
GSMUA_Achr8G31350_001 Musa acuminata GSMUA_Achr8G31350_001 I 0.000
GSMUA_Achr8G33900_001 Musa acuminata GSMUA_Achr8G33900_001 I 0.000
GSMUA_Achr9G08600_001 Musa acuminata GSMUA_Achr9G08600_001 I 0.000
GSMUA_Achr9G24180_001 Musa acuminata GSMUA_Achr9G24180_001 I 0.000
GSMUA_AchrUn_randomG00040_001 Musa acuminata GSMUA_AchrUn_randomG00040_001 I 0.000
GSMUA_AchrUn_randomG07900_001 Musa acuminata GSMUA_AchrUn_randomG07900_001 I 0.000
GSMUA_AchrUn_randomG21080_001 Musa acuminata GSMUA_AchrUn_randomG21080_001 I 0.000
gw1.149.61.1 Physcomitrella patens gw1.149.61.1 I 0.000
gw1.277.32.1 Physcomitrella patens gw1.277.32.1 I 0.000
LjSGA_007368.1 Lotus japonicus LjSGA_007368.1 I 0.000
LjSGA_026563.1 Lotus japonicus LjSGA_026563.1 I 0.000
LjSGA_115006.1 Lotus japonicus LjSGA_115006.1 I 0.000
LPERR01G10930 Leersia perrieri LPERR01G10930 I 0.000
LPERR01G24370 Leersia perrieri LPERR01G24370 I 0.000
LPERR05G02400 Leersia perrieri LPERR05G02400 I 0.000
LPERR07G20400 Leersia perrieri LPERR07G20400 I 0.000
LPERR08G03020 Leersia perrieri LPERR08G03020 I 0.000
LPERR11G04310 Leersia perrieri LPERR11G04310 I 0.000
Lus10002559.g Linum usitatissimum Lus10002559.g I 0.000
Lus10014129.g Linum usitatissimum Lus10014129.g I 0.000
Lus10015608.g Linum usitatissimum Lus10015608.g I 0.000
Lus10016413.g Linum usitatissimum Lus10016413.g I 0.000
Lus10019707.g Linum usitatissimum Lus10019707.g I 0.000
Lus10024669.g Linum usitatissimum Lus10024669.g I 0.000
Lus10027369.g Linum usitatissimum Lus10027369.g I 0.000
Lus10027458.g Linum usitatissimum Lus10027458.g I 0.000
Lus10029520.g Linum usitatissimum Lus10029520.g I 0.000
Lus10031281.g Linum usitatissimum Lus10031281.g I 0.000
Lus10031850.g Linum usitatissimum Lus10031850.g I 0.000
Lus10032298.g Linum usitatissimum Lus10032298.g I 0.000
Lus10033473.g Linum usitatissimum Lus10033473.g I 0.000
Lus10038022.g Linum usitatissimum Lus10038022.g I 0.000
Lus10039213.g Linum usitatissimum Lus10039213.g I 0.000
Lus10039610.g Linum usitatissimum Lus10039610.g I 0.000
MDP0000148894 Malus domestica MDP0000148894 I 0.000
MDP0000152575 Malus domestica MDP0000152575 I 0.000
MDP0000159011 Malus domestica MDP0000159011 I 0.000
MDP0000204495 Malus domestica MDP0000204495 I 0.000
MDP0000249611 Malus domestica MDP0000249611 I 0.000
MDP0000250597 Malus domestica MDP0000250597 I 0.000
MDP0000256645 Malus domestica MDP0000256645 I 0.000
MDP0000263595 Malus domestica MDP0000263595 I 0.000
MDP0000318376 Malus domestica MDP0000318376 I 0.000
MDP0000601420 Malus domestica MDP0000601420 I 0.000
MDP0000653903 Malus domestica MDP0000653903 I 0.000
MDP0000722954 Malus domestica MDP0000722954 I 0.000
MDP0000736994 Malus domestica MDP0000736994 I 0.000
MDP0000787808 Malus domestica MDP0000787808 I 0.000
MDP0000852549 Malus domestica MDP0000852549 I 0.000
MDP0000872821 Malus domestica MDP0000872821 I 0.000
MDP0000932804 Malus domestica MDP0000932804 I 0.000
mgf003709m Mimulus guttatus mgf003709m I 0.000
mgf012705m Mimulus guttatus mgf012705m I 0.000
mgf024107m Mimulus guttatus mgf024107m I 0.000
mgf024114m Mimulus guttatus mgf024114m I 0.000
mgf024753m Mimulus guttatus mgf024753m I 0.000
MLOC_16981 Hordeum vulgare MLOC_16981 I 0.000
MLOC_18177 Hordeum vulgare MLOC_18177 I 0.000
MLOC_59663 Hordeum vulgare MLOC_59663 I 0.000
MLOC_6156 Hordeum vulgare MLOC_6156 I 0.000
MLOC_65957 Hordeum vulgare MLOC_65957 I 0.000
MLOC_66577 Hordeum vulgare MLOC_66577 I 0.000
MTR_1g085040 Medicago truncatula MTR_1g085040 I 0.000
MTR_1g085640 Medicago truncatula MTR_1g085640 I 0.000
MTR_1g100667 Medicago truncatula MTR_1g100667 I 0.000
MTR_1g112760 Medicago truncatula MTR_1g112760 I 0.000
MTR_2g097910 Medicago truncatula MTR_2g097910 I 0.000
MTR_2g099740 Medicago truncatula MTR_2g099740 I 0.000
MTR_3g028740 Medicago truncatula MTR_3g028740 I 0.000
MTR_3g077110 Medicago truncatula MTR_3g077110 I 0.000
MTR_4g065017 Medicago truncatula MTR_4g065017 I 0.000
MTR_4g073420 Medicago truncatula MTR_4g073420 I 0.000
MTR_4g105130 Medicago truncatula MTR_4g105130 I 0.000
MTR_4g485530 Medicago truncatula MTR_4g485530 I 0.000
MTR_5g010020 Medicago truncatula MTR_5g010020 I 0.000
MTR_5g079670 Medicago truncatula MTR_5g079670 I 0.000
MTR_6g055910 Medicago truncatula MTR_6g055910 I 0.000
MTR_7g110830 Medicago truncatula MTR_7g110830 I 0.000
MTR_7g111290 Medicago truncatula MTR_7g111290 I 0.000
MTR_8g017340 Medicago truncatula MTR_8g017340 I 0.000
MTR_8g017350 Medicago truncatula MTR_8g017350 I 0.000
MTR_8g017390 Medicago truncatula MTR_8g017390 I 0.000
MTR_8g017440 Medicago truncatula MTR_8g017440 I 0.000
MTR_8g017540 Medicago truncatula MTR_8g017540 I 0.000
MTR_8g098860 Medicago truncatula MTR_8g098860 I 0.000
OB01G21720 Oryza brachyantha OB01G21720 I 0.000
OB01G37410 Oryza brachyantha OB01G37410 I 0.000
OB05G12630 Oryza brachyantha OB05G12630 I 0.000
OB05G32030 Oryza brachyantha OB05G32030 I 0.000
OB08G13090 Oryza brachyantha OB08G13090 I 0.000
OB09G24400 Oryza brachyantha OB09G24400 I 0.000
OB11G14080 Oryza brachyantha OB11G14080 I 0.000
OB12G21380 Oryza brachyantha OB12G21380 I 0.000
OBART01G11910 Oryza barthii OBART01G11910 I 0.000
OBART01G18830 Oryza barthii OBART01G18830 I 0.000
OBART05G02690 Oryza barthii OBART05G02690 I 0.000
OBART08G03020 Oryza barthii OBART08G03020 I 0.000
OBART11G04950 Oryza barthii OBART11G04950 I 0.000
OBART12G13720 Oryza barthii OBART12G13720 I 0.000
OGLUM01G13340 Oryza glumaepatula OGLUM01G13340 I 0.000
OGLUM01G22380 Oryza glumaepatula OGLUM01G22380 I 0.000
OGLUM05G02680 Oryza glumaepatula OGLUM05G02680 I 0.000
OGLUM07G23470 Oryza glumaepatula OGLUM07G23470 I 0.000
OGLUM08G03030 Oryza glumaepatula OGLUM08G03030 I 0.000
OGLUM11G04790 Oryza glumaepatula OGLUM11G04790 I 0.000
OGLUM12G15400 Oryza glumaepatula OGLUM12G15400 I 0.000
OLONG_008660 Oryza longistaminata OLONG_008660 I 0.000
OLONG_008768 Oryza longistaminata OLONG_008768 I 0.000
OLONG_014417 Oryza longistaminata OLONG_014417 I 0.000
OMERI01G17650 Oryza meridionalis OMERI01G17650 I 0.000
OMERI03G17220 Oryza meridionalis OMERI03G17220 I 0.000
OMERI05G02610 Oryza meridionalis OMERI05G02610 I 0.000
OMERI05G21780 Oryza meridionalis OMERI05G21780 I 0.000
OMERI07G19830 Oryza meridionalis OMERI07G19830 I 0.000
OMERI08G02950 Oryza meridionalis OMERI08G02950 I 0.000
OMERI12G09660 Oryza meridionalis OMERI12G09660 I 0.000
ONIVA01G14120 Oryza nivara ONIVA01G14120 I 0.000
ONIVA01G21360 Oryza nivara ONIVA01G21360 I 0.000
ONIVA02G07540 Oryza nivara ONIVA02G07540 I 0.000
ONIVA05G02580 Oryza nivara ONIVA05G02580 I 0.000
ONIVA05G29400 Oryza nivara ONIVA05G29400 I 0.000
ONIVA06G02400 Oryza nivara ONIVA06G02400 I 0.000
ONIVA11G05280 Oryza nivara ONIVA11G05280 I 0.000
OPUNC01G11600 Oryza punctata OPUNC01G11600 I 0.000
OPUNC01G19230 Oryza punctata OPUNC01G19230 I 0.000
OPUNC01G28160 Oryza punctata OPUNC01G28160 I 0.000
OPUNC03G17950 Oryza punctata OPUNC03G17950 I 0.000
OPUNC05G02540 Oryza punctata OPUNC05G02540 I 0.000
OPUNC07G22080 Oryza punctata OPUNC07G22080 I 0.000
OPUNC08G02760 Oryza punctata OPUNC08G02760 I 0.000
OPUNC11G04750 Oryza punctata OPUNC11G04750 I 0.000
OPUNC12G12380 Oryza punctata OPUNC12G12380 I 0.000
orange1.1g013300m.g Citrus sinensis orange1.1g013300m.g I 0.000
orange1.1g014135m.g Citrus sinensis orange1.1g014135m.g I 0.000
orange1.1g016021m.g Citrus sinensis orange1.1g016021m.g I 0.000
orange1.1g019619m.g Citrus sinensis orange1.1g019619m.g I 0.000
orange1.1g020613m.g Citrus sinensis orange1.1g020613m.g I 0.000
orange1.1g021164m.g Citrus sinensis orange1.1g021164m.g I 0.000
orange1.1g021503m.g Citrus sinensis orange1.1g021503m.g I 0.000
orange1.1g023056m.g Citrus sinensis orange1.1g023056m.g I 0.000
orange1.1g044864m.g Citrus sinensis orange1.1g044864m.g I 0.000
orange1.1g045400m.g Citrus sinensis orange1.1g045400m.g I 0.000
ORGLA01G0100400 Oryza glaberrima ORGLA01G0100400 I 0.000
ORGLA01G0154000 Oryza glaberrima ORGLA01G0154000 I 0.000
ORGLA01G0234600 Oryza glaberrima ORGLA01G0234600 I 0.000
ORGLA05G0025500 Oryza glaberrima ORGLA05G0025500 I 0.000
ORGLA05G0210500 Oryza glaberrima ORGLA05G0210500 I 0.000
ORGLA07G0264800 Oryza glaberrima ORGLA07G0264800 I 0.000
ORGLA08G0023900 Oryza glaberrima ORGLA08G0023900 I 0.000
ORGLA09G0141200 Oryza glaberrima ORGLA09G0141200 I 0.000
ORGLA11G0047500 Oryza glaberrima ORGLA11G0047500 I 0.000
ORGLA12G0120900 Oryza glaberrima ORGLA12G0120900 I 0.000
ORUFI01G12800 Oryza rufipogon ORUFI01G12800 I 0.000
ORUFI01G21210 Oryza rufipogon ORUFI01G21210 I 0.000
ORUFI02G26980 Oryza rufipogon ORUFI02G26980 I 0.000
ORUFI05G02790 Oryza rufipogon ORUFI05G02790 I 0.000
ORUFI07G24600 Oryza rufipogon ORUFI07G24600 I 0.000
ORUFI08G03380 Oryza rufipogon ORUFI08G03380 I 0.000
ORUFI09G19350 Oryza rufipogon ORUFI09G19350 I 0.000
ORUFI11G04860 Oryza rufipogon ORUFI11G04860 I 0.000
ORUFI12G15040 Oryza rufipogon ORUFI12G15040 I 0.000
OS01G0285300 Oryza sativa OS01G0285300 I 0.000
OS01G0709000 Oryza sativa OS01G0709000 I 0.000
OS05G0140100 Oryza sativa OS05G0140100 I 0.000
OS05G0543600 Oryza sativa OS05G0543600 I 0.000
OS08G0151300 Oryza sativa OS08G0151300 I 0.000
OS09G0538400 Oryza sativa OS09G0538400 I 0.000
Pavir.Ba00668 Panicum virgatum Pavir.Ba00668 I 0.000
Pavir.Ba01213 Panicum virgatum Pavir.Ba01213 I 0.000
Pavir.Bb02469 Panicum virgatum Pavir.Bb02469 I 0.000
Pavir.Ca01788 Panicum virgatum Pavir.Ca01788 I 0.000
Pavir.Ca02370 Panicum virgatum Pavir.Ca02370 I 0.000
Pavir.Ea01054 Panicum virgatum Pavir.Ea01054 I 0.000
Pavir.Ea02594 Panicum virgatum Pavir.Ea02594 I 0.000
Pavir.Eb01178 Panicum virgatum Pavir.Eb01178 I 0.000
Pavir.Fb00364 Panicum virgatum Pavir.Fb00364 I 0.000
Pavir.J03230 Panicum virgatum Pavir.J03230 I 0.000
Pavir.J11802 Panicum virgatum Pavir.J11802 I 0.000
Pavir.J16675 Panicum virgatum Pavir.J16675 I 0.000
Pavir.J18139 Panicum virgatum Pavir.J18139 I 0.000
Pavir.J19191 Panicum virgatum Pavir.J19191 I 0.000
Pavir.J20716 Panicum virgatum Pavir.J20716 I 0.000
Pavir.J21520 Panicum virgatum Pavir.J21520 I 0.000
Pavir.J29561 Panicum virgatum Pavir.J29561 I 0.000
Pavir.J31344 Panicum virgatum Pavir.J31344 I 0.000
Pavir.J38204 Panicum virgatum Pavir.J38204 I 0.000
Pavir.J40848 Panicum virgatum Pavir.J40848 I 0.000
PDK_20s1606731g001 Phoenix dactylifera PDK_20s1606731g001 I 0.000
PDK_20s1844641g001 Phoenix dactylifera PDK_20s1844641g001 I 0.000
PDK_20s1854611g001 Phoenix dactylifera PDK_20s1854611g001 I 0.000
PGSC0003DMG400006176 Solanum tuberosum PGSC0003DMG400006176 I 0.000
PGSC0003DMG400006868 Solanum tuberosum PGSC0003DMG400006868 I 0.000
PGSC0003DMG400007360 Solanum tuberosum PGSC0003DMG400007360 I 0.000
PGSC0003DMG400013215 Solanum tuberosum PGSC0003DMG400013215 I 0.000
PGSC0003DMG400014291 Solanum tuberosum PGSC0003DMG400014291 I 0.000
PGSC0003DMG400015767 Solanum tuberosum PGSC0003DMG400015767 I 0.000
PGSC0003DMG400018279 Solanum tuberosum PGSC0003DMG400018279 I 0.000
PGSC0003DMG400027077 Solanum tuberosum PGSC0003DMG400027077 I 0.000
PGSC0003DMG400030548 Solanum tuberosum PGSC0003DMG400030548 I 0.000
PGSC0003DMG400031317 Solanum tuberosum PGSC0003DMG400031317 I 0.000
PGSC0003DMG400037038 Solanum tuberosum PGSC0003DMG400037038 I 0.000
PK02515.1 Cannabis sativa PK02515.1 I 0.000
PK03176.1 Cannabis sativa PK03176.1 I 0.000
PK05970.1 Cannabis sativa PK05970.1 I 0.000
PK11717.1 Cannabis sativa PK11717.1 I 0.000
PK13930.1 Cannabis sativa PK13930.1 I 0.000
PK14287.1 Cannabis sativa PK14287.1 I 0.000
PK21058.1 Cannabis sativa PK21058.1 I 0.000
PK22647.1 Cannabis sativa PK22647.1 I 0.000
PK22855.1 Cannabis sativa PK22855.1 I 0.000
PK29029.1 Cannabis sativa PK29029.1 I 0.000
Pm003267 Prunus mume Pm003267 I 0.000
Pm004199 Prunus mume Pm004199 I 0.000
Pm012272 Prunus mume Pm012272 I 0.000
Pm013322 Prunus mume Pm013322 I 0.000
Pm014372 Prunus mume Pm014372 I 0.000
Pm016295 Prunus mume Pm016295 I 0.000
Pm019344 Prunus mume Pm019344 I 0.000
Pm020852 Prunus mume Pm020852 I 0.000
Pm023937 Prunus mume Pm023937 I 0.000
Pm023938 Prunus mume Pm023938 I 0.000
Pm024326 Prunus mume Pm024326 I 0.000
Pm025103 Prunus mume Pm025103 I 0.000
Pm029185 Prunus mume Pm029185 I 0.000
POPTR_0001s09810 Populus trichocarpa POPTR_0001s09810 I 0.000
MYB26 Populus trichocarpa POPTR_0001s20370 I 0.000
POPTR_0001s26590 Populus trichocarpa POPTR_0001s26590 I 0.000
POPTR_0001s27430 Populus trichocarpa POPTR_0001s27430 I 0.000
POPTR_0002s18700 Populus trichocarpa POPTR_0002s18700 I 0.000
POPTR_0003s13190 Populus trichocarpa POPTR_0003s13190 I 0.000
POPTR_0004s08650 Populus trichocarpa POPTR_0004s08650 I 0.000
POPTR_0004s14510 Populus trichocarpa POPTR_0004s14510 I 0.000
POPTR_0004s18020 Populus trichocarpa POPTR_0004s18020 I 0.000
POPTR_0005s00340 Populus trichocarpa POPTR_0005s00340 I 0.000
POPTR_0005s11410 Populus trichocarpa POPTR_0005s11410 I 0.000
POPTR_0008s12750 Populus trichocarpa POPTR_0008s12750 I 0.000
POPTR_0009s05860 Populus trichocarpa POPTR_0009s05860 I 0.000
POPTR_0009s06630 Populus trichocarpa POPTR_0009s06630 I 0.000
POPTR_0009s13640 Populus trichocarpa POPTR_0009s13640 I 0.000
POPTR_0010s00690 Populus trichocarpa POPTR_0010s00690 I 0.000
POPTR_0010s12420 Populus trichocarpa POPTR_0010s12420 I 0.000
POPTR_0013s00290 Populus trichocarpa POPTR_0013s00290 I 0.000
POPTR_0014s10680 Populus trichocarpa POPTR_0014s10680 I 0.000
POPTR_0015s04300 Populus trichocarpa POPTR_0015s04300 I 0.000
POPTR_0015s09430 Populus trichocarpa POPTR_0015s09430 I 0.000
POPTR_0015s13190 Populus trichocarpa POPTR_0015s13190 I 0.000
POPTR_0017s02990 Populus trichocarpa POPTR_0017s02990 I 0.000
POPTR_0019s00750 Populus trichocarpa POPTR_0019s00750 I 0.000
POPTR_0019s05190 Populus trichocarpa POPTR_0019s05190 I 0.000
POPTR_0019s05200 Populus trichocarpa POPTR_0019s05200 I 0.000
PRUPE_ppa008906mg Prunus persica PRUPE_ppa008906mg I 0.000
PRUPE_ppa009566mg Prunus persica PRUPE_ppa009566mg I 0.000
PRUPE_ppa010277mg Prunus persica PRUPE_ppa010277mg I 0.000
PRUPE_ppa010716mg Prunus persica PRUPE_ppa010716mg I 0.000
PRUPE_ppa010846mg Prunus persica PRUPE_ppa010846mg I 0.000
PRUPE_ppa015032mg Prunus persica PRUPE_ppa015032mg I 0.000
PRUPE_ppa016196mg Prunus persica PRUPE_ppa016196mg I 0.000
PRUPE_ppa016923mg Prunus persica PRUPE_ppa016923mg I 0.000
PRUPE_ppa018561mg Prunus persica PRUPE_ppa018561mg I 0.000
PRUPE_ppa019522mg Prunus persica PRUPE_ppa019522mg I 0.000
PRUPE_ppa019529mg Prunus persica PRUPE_ppa019529mg I 0.000
PRUPE_ppa019718mg Prunus persica PRUPE_ppa019718mg I 0.000
PRUPE_ppa019729mg Prunus persica PRUPE_ppa019729mg I 0.000
SapurV1A.0011s0520 Salix purpurea SapurV1A.0011s0520 I 0.000
SapurV1A.0027s0350 Salix purpurea SapurV1A.0027s0350 I 0.000
SapurV1A.0098s0320 Salix purpurea SapurV1A.0098s0320 I 0.000
SapurV1A.0102s0340 Salix purpurea SapurV1A.0102s0340 I 0.000
SapurV1A.0119s0140 Salix purpurea SapurV1A.0119s0140 I 0.000
SapurV1A.0120s0010 Salix purpurea SapurV1A.0120s0010 I 0.000
SapurV1A.0127s0240 Salix purpurea SapurV1A.0127s0240 I 0.000
SapurV1A.0163s0150 Salix purpurea SapurV1A.0163s0150 I 0.000
SapurV1A.0177s0130 Salix purpurea SapurV1A.0177s0130 I 0.000
SapurV1A.0264s0440 Salix purpurea SapurV1A.0264s0440 I 0.000
SapurV1A.0321s0070 Salix purpurea SapurV1A.0321s0070 I 0.000
SapurV1A.0390s0200 Salix purpurea SapurV1A.0390s0200 I 0.000
SapurV1A.0442s0250 Salix purpurea SapurV1A.0442s0250 I 0.000
SapurV1A.0534s0230 Salix purpurea SapurV1A.0534s0230 I 0.000
SapurV1A.0538s0150 Salix purpurea SapurV1A.0538s0150 I 0.000
SapurV1A.0591s0010 Salix purpurea SapurV1A.0591s0010 I 0.000
SapurV1A.0923s0040 Salix purpurea SapurV1A.0923s0040 I 0.000
SapurV1A.0925s0070 Salix purpurea SapurV1A.0925s0070 I 0.000
SapurV1A.1016s0030 Salix purpurea SapurV1A.1016s0030 I 0.000
SapurV1A.1077s0040 Salix purpurea SapurV1A.1077s0040 I 0.000
SapurV1A.1127s0040 Salix purpurea SapurV1A.1127s0040 I 0.000
SapurV1A.1253s0100 Salix purpurea SapurV1A.1253s0100 I 0.000
SapurV1A.1387s0090 Salix purpurea SapurV1A.1387s0090 I 0.000
SapurV1A.1730s0020 Salix purpurea SapurV1A.1730s0020 I 0.000
SapurV1A.1807s0010 Salix purpurea SapurV1A.1807s0010 I 0.000
SapurV1A.1869s0040 Salix purpurea SapurV1A.1869s0040 I 0.000
SapurV1A.2094s0030 Salix purpurea SapurV1A.2094s0030 I 0.000
SapurV1A.3474s0020 Salix purpurea SapurV1A.3474s0020 I 0.000
Sb01g034270 Sorghum bicolor Sb01g034270 I 0.000
Sb02g031190 Sorghum bicolor Sb02g031190 I 0.000
Sb02g036250 Sorghum bicolor Sb02g036250 I 0.000
Sb02g040480 Sorghum bicolor Sb02g040480 I 0.000
Sb03g011640 Sorghum bicolor Sb03g011640 I 0.000
Sb03g024500 Sorghum bicolor Sb03g024500 I 0.000
Sb03g032600 Sorghum bicolor Sb03g032600 I 0.000
Sb07g003320 Sorghum bicolor Sb07g003320 I 0.000
Sb07g024890 Sorghum bicolor Sb07g024890 I 0.000
Sb08g016620 Sorghum bicolor Sb08g016620 I 0.000
Sb09g003100 Sorghum bicolor Sb09g003100 I 0.000
Sb09g027200 Sorghum bicolor Sb09g027200 I 0.000
MYB61 Arabidopsis lyrata scaffold_100991.1 I 0.000
MYB7 Arabidopsis lyrata scaffold_303957.1 I 0.000
ATMYB46 Arabidopsis lyrata scaffold_601291.1 I 0.000
AtMYB32 Arabidopsis lyrata scaffold_700628.1 I 0.000
SELMODRAFT_437219 Selaginella moellendorffii SELMODRAFT_437219 I 0.000
Si001565m.g Setaria italica Si001565m.g I 0.000
Si002220m.g Setaria italica Si002220m.g I 0.000
Si002319m.g Setaria italica Si002319m.g I 0.000
Si015081m.g Setaria italica Si015081m.g I 0.000
Si022113m.g Setaria italica Si022113m.g I 0.000
Si022730m.g Setaria italica Si022730m.g I 0.000
Si024786m.g Setaria italica Si024786m.g I 0.000
Si029872m.g Setaria italica Si029872m.g I 0.000
Si030273m.g Setaria italica Si030273m.g I 0.000
Si030943m.g Setaria italica Si030943m.g I 0.000
Si036638m.g Setaria italica Si036638m.g I 0.000
Solyc01g087130.2 Solanum lycopersicum Solyc01g087130.2 I 0.000
Solyc01g102340.2 Solanum lycopersicum Solyc01g102340.2 I 0.000
Solyc01g111500.2 Solanum lycopersicum Solyc01g111500.2 I 0.000
Solyc03g025870.2 Solanum lycopersicum Solyc03g025870.2 I 0.000
Solyc03g121740.1 Solanum lycopersicum Solyc03g121740.1 I 0.000
Solyc05g008250.1 Solanum lycopersicum Solyc05g008250.1 I 0.000
Solyc06g065100.2 Solanum lycopersicum Solyc06g065100.2 I 0.000
Solyc06g071690.2 Solanum lycopersicum Solyc06g071690.2 I 0.000
Solyc08g081500.1 Solanum lycopersicum Solyc08g081500.1 I 0.000
Solyc10g044680.1 Solanum lycopersicum Solyc10g044680.1 I 0.000
Solyc10g055410.1 Solanum lycopersicum Solyc10g055410.1 I 0.000
Solyc11g065840.1 Solanum lycopersicum Solyc11g065840.1 I 0.000
TCM_000174 Theobroma cacao TCM_000174 I 0.000
TCM_004965 Theobroma cacao TCM_004965 I 0.000
TCM_005885 Theobroma cacao TCM_005885 I 0.000
TCM_006638 Theobroma cacao TCM_006638 I 0.000
TCM_010839 Theobroma cacao TCM_010839 I 0.000
TCM_012174 Theobroma cacao TCM_012174 I 0.000
TCM_012631 Theobroma cacao TCM_012631 I 0.000
TCM_015157 Theobroma cacao TCM_015157 I 0.000
TCM_016332 Theobroma cacao TCM_016332 I 0.000
TCM_019261 Theobroma cacao TCM_019261 I 0.000
TCM_026853 Theobroma cacao TCM_026853 I 0.000
TCM_029065 Theobroma cacao TCM_029065 I 0.000
TCM_036404 Theobroma cacao TCM_036404 I 0.000
TCM_040694 Theobroma cacao TCM_040694 I 0.000
Thhalv10004450m.g Eutrema salsugineum Thhalv10004450m.g I 0.000
Thhalv10008000m.g Eutrema salsugineum Thhalv10008000m.g I 0.000
Thhalv10008456m.g Eutrema salsugineum Thhalv10008456m.g I 0.000
Thhalv10015560m.g Eutrema salsugineum Thhalv10015560m.g I 0.000
Thhalv10021042m.g Eutrema salsugineum Thhalv10021042m.g I 0.000
Thhalv10021052m.g Eutrema salsugineum Thhalv10021052m.g I 0.000
Thhalv10022799m.g Eutrema salsugineum Thhalv10022799m.g I 0.000
Thhalv10023601m.g Eutrema salsugineum Thhalv10023601m.g I 0.000
Thhalv10023948m.g Eutrema salsugineum Thhalv10023948m.g I 0.000
Thhalv10025886m.g Eutrema salsugineum Thhalv10025886m.g I 0.000
Thhalv10025926m.g Eutrema salsugineum Thhalv10025926m.g I 0.000
Thhalv10028778m.g Eutrema salsugineum Thhalv10028778m.g I 0.000
Thhalv10028864m.g Eutrema salsugineum Thhalv10028864m.g I 0.000
TRAES3BF071400020CFD_g Triticum aestivum TRAES3BF071400020CFD_g I 0.000
Traes_1AS_1EE692FDC Triticum aestivum Traes_1AS_1EE692FDC I 0.000
Traes_1BS_92EA1F290 Triticum aestivum Traes_1BS_92EA1F290 I 0.000
Traes_1DS_5BAD8947E Triticum aestivum Traes_1DS_5BAD8947E I 0.000
Traes_2AS_731C703DE Triticum aestivum Traes_2AS_731C703DE I 0.000
Traes_2BS_E1E541767 Triticum aestivum Traes_2BS_E1E541767 I 0.000
Traes_2DS_3569AEDFB Triticum aestivum Traes_2DS_3569AEDFB I 0.000
Traes_3AL_E3BF20F0D Triticum aestivum Traes_3AL_E3BF20F0D I 0.000
Traes_4AL_CC5803BED Triticum aestivum Traes_4AL_CC5803BED I 0.000
Traes_4BS_6253482BD Triticum aestivum Traes_4BS_6253482BD I 0.000
Traes_4DS_7BFAC49C2 Triticum aestivum Traes_4DS_7BFAC49C2 I 0.000
Traes_5AL_56F30392D Triticum aestivum Traes_5AL_56F30392D I 0.000
Traes_5BL_AED68C680 Triticum aestivum Traes_5BL_AED68C680 I 0.000
Traes_5BS_2CB91C54A Triticum aestivum Traes_5BS_2CB91C54A I 0.000
Traes_5DL_1868E2A6C Triticum aestivum Traes_5DL_1868E2A6C I 0.000
Traes_5DS_AACA2EBA3 Triticum aestivum Traes_5DS_AACA2EBA3 I 0.000
Traes_7AL_04D939077 Triticum aestivum Traes_7AL_04D939077 I 0.000
Traes_7DL_5BD0D4BD1 Triticum aestivum Traes_7DL_5BD0D4BD1 I 0.000
TRIUR3_11890 Triticum urartu TRIUR3_11890 I 0.000
TRIUR3_24104 Triticum urartu TRIUR3_24104 I 0.000
TRIUR3_25230 Triticum urartu TRIUR3_25230 I 0.000
TRIUR3_27020 Triticum urartu TRIUR3_27020 I 0.000
TRIUR3_33254 Triticum urartu TRIUR3_33254 I 0.000
VIT_01s0011g04760 Vitis vinifera VIT_01s0011g04760 I 0.000
AtMYB103 Vitis vinifera VIT_02s0025g00320 I 0.000
VIT_03s0038g02310 Vitis vinifera VIT_03s0038g02310 I 0.000
VIT_05s0020g01100 Vitis vinifera VIT_05s0020g01100 I 0.000
VIT_06s0004g02110 Vitis vinifera VIT_06s0004g02110 I 0.000
VIT_07s0005g02480 Vitis vinifera VIT_07s0005g02480 I 0.000
MYB26 Vitis vinifera VIT_09s0002g01670 I 0.000
MYB83 Vitis vinifera VIT_13s0064g00960 I 0.000
VIT_14s0006g01620 Vitis vinifera VIT_14s0006g01620 I 0.000
VIT_14s0060g00240 Vitis vinifera VIT_14s0060g00240 I 0.000
VIT_16s0050g00050 Vitis vinifera VIT_16s0050g00050 I 0.000
VIT_17s0000g02660 Vitis vinifera VIT_17s0000g02660 I 0.000
VIT_17s0000g09080 Vitis vinifera VIT_17s0000g09080 I 0.000