LPERR02G30830 (Leersia perrieri)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 LPERR02G30830 T273682_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.792 0.872
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.792 0.872
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.792 0.872
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.792 0.872
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.774 0.851
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
LPERR02G30830.1 Myb 555 605
LPERR02G30830.2 Myb 535 585

Links

Other Myb/SANT family TFs
Other Leersia perrieri TFs

196 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
30054.m000824 Ricinus communis 30054.m000824 N 0.000
Al_scaffold_0001_3341 Arabidopsis lyrata Al_scaffold_0001_3341 N 0.000
Aquca_005_00468 Aquilegia coerulea Aquca_005_00468 N 0.000
Aquca_009_01064 Aquilegia coerulea Aquca_009_01064 N 0.000
AT1G32700 Arabidopsis thaliana AT1G32700 N 0.000
BGIOSGA005806 Oryza indica BGIOSGA005806 N 0.000
BGIOSGA031347 Oryza indica BGIOSGA031347 N 0.000
Bostr.3359s0088 Boechera stricta Bostr.3359s0088 N 0.000
BRADI3G34160 Brachypodium distachyon BRADI3G34160 N 0.000
Cagra.4962s0001 Capsella grandiflora Cagra.4962s0001 N 0.000
Carubv10009979m.g Capsella rubella Carubv10009979m.g N 0.000
cassava22380.valid.m1 Manihot esculenta cassava22380.valid.m1 N 0.000
cassava37607.valid.m1 Manihot esculenta cassava37607.valid.m1 N 0.000
Ca_00735 Cicer arietinum Ca_00735 N 0.000
Ca_11505 Cicer arietinum Ca_11505 N 0.000
Ca_11837 Cicer arietinum Ca_11837 N 0.000
Ciclev10012712m.g Citrus clementina Ciclev10012712m.g N 0.000
Ciclev10032089m.g Citrus clementina Ciclev10032089m.g N 0.000
Cla016461 Citrullus lanatus Cla016461 N 0.000
Cucsa.313040 Cucumis sativus Cucsa.313040 N 0.000
Cucsa.318510 Cucumis sativus Cucsa.318510 N 0.000
Cucsa.378840 Cucumis sativus Cucsa.378840 N 0.000
Eucgr.A01594 Eucalyptus grandis Eucgr.A01594 N 0.000
Eucgr.D02206 Eucalyptus grandis Eucgr.D02206 N 0.000
Eucgr.E00276 Eucalyptus grandis Eucgr.E00276 N 0.000
evm.TU.supercontig_30.61 Carica papaya evm.TU.supercontig_30.61 N 0.000
evm.TU.supercontig_43.104 Carica papaya evm.TU.supercontig_43.104 N 0.000
evm.TU.supercontig_5.128 Carica papaya evm.TU.supercontig_5.128 N 0.000
e_gw1.1.253.1 Physcomitrella patens e_gw1.1.253.1 N 0.000
fgenesh1_pg.scaffold_102000043 Physcomitrella patens fgenesh1_pg.scaffold_102000043 N 0.000
gene02186-v1.0-hybrid Fragaria vesca gene02186-v1.0-hybrid N 0.000
GLYMA01G02180 Glycine max GLYMA01G02180 N 0.000
GLYMA01G11390 Glycine max GLYMA01G11390 N 0.000
GLYMA01G44430 Glycine max GLYMA01G44430 N 0.000
GLYMA03G34530 Glycine max GLYMA03G34530 N 0.000
GLYMA08G36641 Glycine max GLYMA08G36641 N 0.000
GLYMA09G33770 Glycine max GLYMA09G33770 N 0.000
GLYMA11G01100 Glycine max GLYMA11G01100 N 0.000
GLYMA13G21140 Glycine max GLYMA13G21140 N 0.000
Gorai.003G056500 Gossypium raimondii Gorai.003G056500 N 0.000
Gorai.003G183000 Gossypium raimondii Gorai.003G183000 N 0.000
Gorai.006G159900 Gossypium raimondii Gorai.006G159900 N 0.000
Gorai.006G217100 Gossypium raimondii Gorai.006G217100 N 0.000
Gorai.007G032400 Gossypium raimondii Gorai.007G032400 N 0.000
Gorai.008G226100 Gossypium raimondii Gorai.008G226100 N 0.000
Gorai.013G184000 Gossypium raimondii Gorai.013G184000 N 0.000
GRMZM2G086403 Zea mays GRMZM2G086403 N 0.000
GRMZM2G091044 Zea mays GRMZM2G091044 N 0.000
GRMZM2G094168 Zea mays GRMZM2G094168 N 0.000
GRMZM2G408887 Zea mays GRMZM2G408887 N 0.000
GSMUA_Achr11G17810_001 Musa acuminata GSMUA_Achr11G17810_001 N 0.000
GSMUA_Achr2G18160_001 Musa acuminata GSMUA_Achr2G18160_001 N 0.000
GSMUA_Achr4G19110_001 Musa acuminata GSMUA_Achr4G19110_001 N 0.000
GSMUA_Achr5G03420_001 Musa acuminata GSMUA_Achr5G03420_001 N 0.000
GSMUA_Achr5G13970_001 Musa acuminata GSMUA_Achr5G13970_001 N 0.000
GSMUA_Achr5G18120_001 Musa acuminata GSMUA_Achr5G18120_001 N 0.000
GSMUA_Achr8G14740_001 Musa acuminata GSMUA_Achr8G14740_001 N 0.000
LPERR02G23300 Leersia perrieri LPERR02G23300 N 0.000
LPERR10G15280 Leersia perrieri LPERR10G15280 N 0.000
Lus10000482.g Linum usitatissimum Lus10000482.g N 0.000
Lus10004577.g Linum usitatissimum Lus10004577.g N 0.000
Lus10027735.g Linum usitatissimum Lus10027735.g N 0.000
Lus10030968.g Linum usitatissimum Lus10030968.g N 0.000
Lus10035554.g Linum usitatissimum Lus10035554.g N 0.000
Lus10040082.g Linum usitatissimum Lus10040082.g N 0.000
MDP0000553473 Malus domestica MDP0000553473 N 0.000
MDP0000570901 Malus domestica MDP0000570901 N 0.000
mgf023930m Mimulus guttatus mgf023930m N 0.000
MLOC_63157 Hordeum vulgare MLOC_63157 N 0.000
MTR_5g007230 Medicago truncatula MTR_5g007230 N 0.000
MTR_5g030130 Medicago truncatula MTR_5g030130 N 0.000
MTR_7g102790 Medicago truncatula MTR_7g102790 N 0.000
MTR_8g066820 Medicago truncatula MTR_8g066820 N 0.000
OB02G35810 Oryza brachyantha OB02G35810 N 0.000
OB10G26540 Oryza brachyantha OB10G26540 N 0.000
OBART02G28660 Oryza barthii OBART02G28660 N 0.000
OGLUM02G29250 Oryza glumaepatula OGLUM02G29250 N 0.000
OGLUM10G19490 Oryza glumaepatula OGLUM10G19490 N 0.000
OLONG_011823 Oryza longistaminata OLONG_011823 N 0.000
OLONG_023395 Oryza longistaminata OLONG_023395 N 0.000
ONIVA02G31400 Oryza nivara ONIVA02G31400 N 0.000
ONIVA10G22010 Oryza nivara ONIVA10G22010 N 0.000
OPUNC02G26310 Oryza punctata OPUNC02G26310 N 0.000
OPUNC10G17840 Oryza punctata OPUNC10G17840 N 0.000
orange1.1g026096m.g Citrus sinensis orange1.1g026096m.g N 0.000
orange1.1g027730m.g Citrus sinensis orange1.1g027730m.g N 0.000
ORGLA02G0246600 Oryza glaberrima ORGLA02G0246600 N 0.000
ORGLA10G0145900 Oryza glaberrima ORGLA10G0145900 N 0.000
ORUFI02G30220 Oryza rufipogon ORUFI02G30220 N 0.000
ORUFI10G20640 Oryza rufipogon ORUFI10G20640 N 0.000
OS02G0692700 Oryza sativa OS02G0692700 N 0.000
OS10G0574700 Oryza sativa OS10G0574700 N 0.000
Pavir.Aa01152 Panicum virgatum Pavir.Aa01152 N 0.000
Pavir.Ab01769 Panicum virgatum Pavir.Ab01769 N 0.000
Pavir.J05501 Panicum virgatum Pavir.J05501 N 0.000
PGSC0003DMG400008598 Solanum tuberosum PGSC0003DMG400008598 N 0.000
PK29286.1 Cannabis sativa PK29286.1 N 0.000
Pm023220 Prunus mume Pm023220 N 0.000
POPTR_0001s02390 Populus trichocarpa POPTR_0001s02390 N 0.000
POPTR_0003s09160 Populus trichocarpa POPTR_0003s09160 N 0.000
PRUPE_ppa011266mg Prunus persica PRUPE_ppa011266mg N 0.000
SapurV1A.0226s0270 Salix purpurea SapurV1A.0226s0270 N 0.000
SapurV1A.0360s0060 Salix purpurea SapurV1A.0360s0060 N 0.000
Sb01g028260 Sorghum bicolor Sb01g028260 N 0.000
Sb04g031230 Sorghum bicolor Sb04g031230 N 0.000
Si035718m.g Setaria italica Si035718m.g N 0.000
Solyc10g085800.1 Solanum lycopersicum Solyc10g085800.1 N 0.000
TCM_015701 Theobroma cacao TCM_015701 N 0.000
TCM_025548 Theobroma cacao TCM_025548 N 0.000
Traes_1AL_791D3B325 Triticum aestivum Traes_1AL_791D3B325 N 0.000
Traes_1BL_C202F3DE1 Triticum aestivum Traes_1BL_C202F3DE1 N 0.000
VIT_02s0012g01400 Vitis vinifera VIT_02s0012g01400 N 0.000
VIT_16s0039g01560 Vitis vinifera VIT_16s0039g01560 N 0.000