LPERR02G30830 (Leersia perrieri)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 LPERR02G30830 T273682_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.792 0.872
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.792 0.872
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.792 0.872
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.792 0.872
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.774 0.851
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
LPERR02G30830.1 Myb 555 605
LPERR02G30830.2 Myb 535 585

Links

Other Myb/SANT family TFs
Other Leersia perrieri TFs

196 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ARF3 Arabidopsis thaliana AT2G33860 D 0.000
TCM_029792 Theobroma cacao TCM_029792 I 0.000
Cucsa.046570 Cucumis sativus Cucsa.046570 I 0.000
mgf011102m Mimulus guttatus mgf011102m I 0.000
mgf016063m Mimulus guttatus mgf016063m I 0.000
Aquca_027_00067 Aquilegia coerulea Aquca_027_00067 I 0.000
Aquca_036_00025 Aquilegia coerulea Aquca_036_00025 I 0.000
Aquca_051_00062 Aquilegia coerulea Aquca_051_00062 I 0.000
Bostr.23794s0705 Boechera stricta Bostr.23794s0705 I 0.000
Bostr.26833s0196 Boechera stricta Bostr.26833s0196 I 0.000
Cagra.1195s0014 Capsella grandiflora Cagra.1195s0014 I 0.000
Cagra.2519s0017 Capsella grandiflora Cagra.2519s0017 I 0.000
Carubv10025185m.g Capsella rubella Carubv10025185m.g I 0.000
Carubv10025912m.g Capsella rubella Carubv10025912m.g I 0.000
Ciclev10000976m.g Citrus clementina Ciclev10000976m.g I 0.000
cassava6009.valid.m1 Manihot esculenta cassava6009.valid.m1 I 0.000
cassava1599.valid.m1 Manihot esculenta cassava1599.valid.m1 I 0.000
Traes_1AL_B14FE48AF Triticum aestivum Traes_1AL_B14FE48AF I 0.000
Traes_1DL_92BCA55C0 Triticum aestivum Traes_1DL_92BCA55C0 I 0.000
Traes_3AL_A30A3C355 Triticum aestivum Traes_3AL_A30A3C355 I 0.000
TRIUR3_14814 Triticum urartu TRIUR3_14814 I 0.000
TRIUR3_33948 Triticum urartu TRIUR3_33948 I 0.000
TRIUR3_35254 Triticum urartu TRIUR3_35254 I 0.000
ARF4 Vitis vinifera VIT_06s0004g03130 I 0.000
ETT Vitis vinifera VIT_10s0003g00420 I 0.000
Ca_06352 Cicer arietinum Ca_06352 I 0.000
Cla009812 Citrullus lanatus Cla009812 I 0.000
Pm000994 Prunus mume Pm000994 I 0.000
Pm031349 Prunus mume Pm031349 I 0.000
29900.m001540 Ricinus communis 29900.m001540 I 0.000
Ciclev10014391m.g Citrus clementina Ciclev10014391m.g I 0.000
Ciclev10027839m.g Citrus clementina Ciclev10027839m.g I 0.000
Eucgr.B02480 Eucalyptus grandis Eucgr.B02480 I 0.000
orange1.1g004106m.g Citrus sinensis orange1.1g004106m.g I 0.000
orange1.1g012439m.g Citrus sinensis orange1.1g012439m.g I 0.000
Pavir.Ca00928 Panicum virgatum Pavir.Ca00928 I 0.000
SapurV1A.0012s0780 Salix purpurea SapurV1A.0012s0780 I 0.000
SapurV1A.0032s0660 Salix purpurea SapurV1A.0032s0660 I 0.000
SapurV1A.0240s0100 Salix purpurea SapurV1A.0240s0100 I 0.000
Thhalv10012728m.g Eutrema salsugineum Thhalv10012728m.g I 0.000
Thhalv10016394m.g Eutrema salsugineum Thhalv10016394m.g I 0.000
PK07904.1 Cannabis sativa PK07904.1 I 0.000
PK18282.1 Cannabis sativa PK18282.1 I 0.000
LjSGA_059669.1 Lotus japonicus LjSGA_059669.1 I 0.000
LjSGA_103336.1 Lotus japonicus LjSGA_103336.1 I 0.000
PDK_20s1465161g002 Phoenix dactylifera PDK_20s1465161g002 I 0.000
orange1.1g003580m.g Citrus sinensis orange1.1g003580m.g I 0.000
MDP0000412781 Malus domestica MDP0000412781 I 0.000
Eucgr.D00588 Eucalyptus grandis Eucgr.D00588 I 0.000
evm.TU.supercontig_139.80 Carica papaya evm.TU.supercontig_139.80 I 0.000
evm.TU.supercontig_7.3 Carica papaya evm.TU.supercontig_7.3 I 0.000
gene28545-v1.0-hybrid Fragaria vesca gene28545-v1.0-hybrid I 0.000
gene29771-v1.0-hybrid Fragaria vesca gene29771-v1.0-hybrid I 0.000
Gorai.009G078800 Gossypium raimondii Gorai.009G078800 I 0.000
Gorai.009G166100 Gossypium raimondii Gorai.009G166100 I 0.000
Gorai.010G157400 Gossypium raimondii Gorai.010G157400 I 0.000
Gorai.011G030900 Gossypium raimondii Gorai.011G030900 I 0.000
Lus10013942.g Linum usitatissimum Lus10013942.g I 0.000
MDP0000173151 Malus domestica MDP0000173151 I 0.000
MDP0000179650 Malus domestica MDP0000179650 I 0.000
MDP0000225980 Malus domestica MDP0000225980 I 0.000
PDK_20s1663351g001 Phoenix dactylifera PDK_20s1663351g001 I 0.000
AMTR_s00034p00110140 Amborella trichopoda AMTR_s00034p00110140 I 0.000
GLYMA13G24240 Glycine max GLYMA13G24240 I 0.000
GLYMA13G40310 Glycine max GLYMA13G40310 I 0.000
GLYMA15G08540 Glycine max GLYMA15G08540 I 0.000
GRMZM2G030710 Zea mays GRMZM2G030710 I 0.000
GRMZM2G437460 Zea mays GRMZM2G437460 I 0.000
GSMUA_Achr7G11000_001 Musa acuminata GSMUA_Achr7G11000_001 I 0.000
GSMUA_Achr7G25330_001 Musa acuminata GSMUA_Achr7G25330_001 I 0.000
LPERR01G26810 Leersia perrieri LPERR01G26810 I 0.000
LPERR05G18660 Leersia perrieri LPERR05G18660 I 0.000
MLOC_25537 Hordeum vulgare MLOC_25537 I 0.000
MLOC_38232 Hordeum vulgare MLOC_38232 I 0.000
MTR_2g014770 Medicago truncatula MTR_2g014770 I 0.000
MTR_2g093740 Medicago truncatula MTR_2g093740 I 0.000
GLYMA12G29280 Glycine max GLYMA12G29280 I 0.000
GLYMA12G07560 Glycine max GLYMA12G07560 I 0.000
ARF4 Arabidopsis thaliana AT5G60450 I 0.000
BGIOSGA000812 Oryza indica BGIOSGA000812 I 0.000
Bo2g024860 Brassica oleracea Bo2g024860 I 0.000
Bo4g182310 Brassica oleracea Bo4g182310 I 0.000
Bo9g143570 Brassica oleracea Bo9g143570 I 0.000
Bra002479 Brassica rapa Bra002479 I 0.000
Bra021885 Brassica rapa Bra021885 I 0.000
BRADI2G16610 Brachypodium distachyon BRADI2G16610 I 0.000
BRADI2G19867 Brachypodium distachyon BRADI2G19867 I 0.000
BRADI2G46190 Brachypodium distachyon BRADI2G46190 I 0.000
BRADI2G50120 Brachypodium distachyon BRADI2G50120 I 0.000
ARF4 Arabidopsis lyrata fgenesh2_kg.8__2008__AT5G60450.1 I 0.000
GLYMA07G32300 Glycine max GLYMA07G32300 I 0.000
MTR_4g088210 Medicago truncatula MTR_4g088210 I 0.000
OB01G40150 Oryza brachyantha OB01G40150 I 0.000
OB05G30280 Oryza brachyantha OB05G30280 I 0.000
ORUFI05G27690 Oryza rufipogon ORUFI05G27690 I 0.000
ARF3 Oryza sativa OS01G0753500 I 0.000
OS05G0515400 Oryza sativa OS05G0515400 I 0.000
ARF15 Oryza sativa OS05G0563400 I 0.000
PGSC0003DMG400008065 Solanum tuberosum PGSC0003DMG400008065 I 0.000
PGSC0003DMG400031769 Solanum tuberosum PGSC0003DMG400031769 I 0.000
POPTR_0004s04970 Populus trichocarpa POPTR_0004s04970 I 0.000
POPTR_0009s01700 Populus trichocarpa POPTR_0009s01700 I 0.000
POPTR_0011s05830 Populus trichocarpa POPTR_0011s05830 I 0.000
PRUPE_ppa001557mg Prunus persica PRUPE_ppa001557mg I 0.000
PRUPE_ppa002065m1g Prunus persica PRUPE_ppa002065m1g I 0.000
ETT Arabidopsis lyrata scaffold_401977.1 I 0.000
Solyc02g077560.2 Solanum lycopersicum Solyc02g077560.2 I 0.000
ORUFI05G24090 Oryza rufipogon ORUFI05G24090 I 0.000
ORUFI01G34340 Oryza rufipogon ORUFI01G34340 I 0.000
OBART01G31160 Oryza barthii OBART01G31160 I 0.000
OBART05G22670 Oryza barthii OBART05G22670 I 0.000
OGLUM01G35360 Oryza glumaepatula OGLUM01G35360 I 0.000
OGLUM05G23980 Oryza glumaepatula OGLUM05G23980 I 0.000
OLONG_019459 Oryza longistaminata OLONG_019459 I 0.000
OMERI01G28330 Oryza meridionalis OMERI01G28330 I 0.000
OMERI02G35490 Oryza meridionalis OMERI02G35490 I 0.000
OMERI05G20390 Oryza meridionalis OMERI05G20390 I 0.000
ONIVA01G35630 Oryza nivara ONIVA01G35630 I 0.000
ONIVA05G23630 Oryza nivara ONIVA05G23630 I 0.000
OPUNC01G30260 Oryza punctata OPUNC01G30260 I 0.000
OPUNC05G20300 Oryza punctata OPUNC05G20300 I 0.000
ORGLA05G0198900 Oryza glaberrima ORGLA05G0198900 I 0.000
Solyc11g069190.1 Solanum lycopersicum Solyc11g069190.1 I 0.000