LPERR03G10840 (Leersia perrieri)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 LPERR03G10840 T273685_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.936
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.936
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
LPERR03G10840.1 Myb 574 624

Links

Other Myb/SANT family TFs
Other Leersia perrieri TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ZBTB43 Homo sapiens ENSG00000169155 D 0.000
ENSAMEG00000019654 Ailuropoda melanoleuca ENSAMEG00000019654 I 0.000
ZBTB43 Oryctolagus cuniculus ENSOCUG00000009799 I 0.000
ZBTB43 Otolemur garnettii ENSOGAG00000002029 I 0.000
ZBTB43 Ochotona princeps ENSOPRG00000011453 I 0.000
ENSPANG00000000295 Papio anubis ENSPANG00000000295 I 0.000
ZBTB43 Procavia capensis ENSPCAG00000006897 I 0.000
ENSPPYG00000019615 Pongo abelii ENSPPYG00000019615 I 0.000
ZBTB43 Pan troglodytes ENSPTRG00000021378 I 0.000
ZBTB43 Pteropus vampyrus ENSPVAG00000017706 I 0.000
Zbtb43 Rattus norvegicus ENSRNOG00000017017 I 0.000
ZBTB43 Sorex araneus ENSSARG00000013849 I 0.000
ENSSSCG00000029288 Sus scrofa ENSSSCG00000029288 I 0.000
ZBTB43 Tursiops truncatus ENSTTRG00000009614 I 0.000
Aan_R008070 Calypte anna Aan_R008070 I 0.000
ENSBTAP00000004465-D1 Bos grunniens ENSBTAP00000004465-D1 I 0.000
ENSOARG00000012600 Ovis aries ENSOARG00000012600 I 0.000
ENSNLEG00000017415 Nomascus leucogenys ENSNLEG00000017415 I 0.000
Zbtb43 Mus musculus ENSMUSG00000026788 I 0.000
ZBTB43 Bos taurus ENSBTAG00000003438 I 0.000
ZBTB43 Callithrix jacchus ENSCJAG00000017939 I 0.000
ENSCSAG00000019711 Chlorocebus sabaeus ENSCSAG00000019711 I 0.000
ZBTB43 Dasypus novemcinctus ENSDNOG00000032194 I 0.000
ENSDORG00000001810 Dipodomys ordii ENSDORG00000001810 I 0.000
ZBTB43 Equus caballus ENSECAG00000013239 I 0.000
ZBTB43 Erinaceus europaeus ENSEEUG00000009258 I 0.000
ZBTB43 Echinops telfairi ENSETEG00000000019 I 0.000
ZBTB43 Felis catus ENSFCAG00000031874 I 0.000
ZBTB43 Gorilla gorilla ENSGGOG00000017180 I 0.000
ZBTB43 Loxodonta africana ENSLAFG00000011314 I 0.000
ZBTB43 Myotis lucifugus ENSMLUG00000010893 I 0.000
ZBTB43 Macaca mulatta ENSMMUG00000013640 I 0.000
ENSMPUG00000019227 Mustela putorius furo ENSMPUG00000019227 I 0.000
ENSP00000362556 Macaca fascicularis ENSP00000362556 I 0.000