PGSC0003DMG400030324 (Solanum tuberosum)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 PGSC0003DMG400030324 T277711_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.979
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
PGSC0003DMT400077968 Myb 301 351
PGSC0003DMT400077969 Myb 596 646

Links

Other Myb/SANT family TFs
Other Solanum tuberosum TFs

198 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AGABI2DRAFT_121547 Agaricus bisporus AGABI2DRAFT_121547 N 0.000
BN946_scf184788.g15 Trametes cinnabarina BN946_scf184788.g15 N 0.000
BOTBODRAFT_30261 Botryobasidium botryosum BOTBODRAFT_30261 N 0.000
CC1G_02158 Coprinopsis cinerea CC1G_02158 N 0.000
CERSUDRAFT_116659 Ceriporiopsis subvermispora CERSUDRAFT_116659 N 0.000
CY34DRAFT_809540 Suillus luteus CY34DRAFT_809540 N 0.000
DICSQDRAFT_138828 Dichomitus squalens DICSQDRAFT_138828 N 0.000
fgenesh2_pm.C_scaffold_5000214 Heterobasidion annosum fgenesh2_pm.C_scaffold_5000214 N 0.000
FIBRA_04369 Fibroporia radiculosa FIBRA_04369 N 0.000
FOMPIDRAFT_76327 Fomitopsis pinicola FOMPIDRAFT_76327 N 0.000
GALMADRAFT_1295974 Galerina marginata GALMADRAFT_1295974 N 0.000
GLOTRDRAFT_27195 Gloeophyllum trabeum GLOTRDRAFT_27195 N 0.000
HETIRDRAFT_445496 Heterobasidion irregulare HETIRDRAFT_445496 N 0.000
HYDPIDRAFT_28799 Hydnomerulius pinastri HYDPIDRAFT_28799 N 0.000
K443DRAFT_684920 Laccaria amethystina K443DRAFT_684920 N 0.000
LACBIDRAFT_307744 Laccaria bicolor LACBIDRAFT_307744 N 0.000
M378DRAFT_595224 Amanita muscaria M378DRAFT_595224 N 0.000
M404DRAFT_31022 Pisolithus tinctorius M404DRAFT_31022 N 0.000
M413DRAFT_256733 Hebeloma cylindrosporum M413DRAFT_256733 N 0.000
Moror_2623 Moniliophthora roreri Moror_2623 N 0.000
PAXRUDRAFT_134339 Paxillus rubicundulus PAXRUDRAFT_134339 N 0.000
PHACADRAFT_260934 Phanerochaete carnosa PHACADRAFT_260934 N 0.000
PHLGIDRAFT_35738 Phlebiopsis gigantea PHLGIDRAFT_35738 N 0.000
PIIN_05229 Piriformospora indica PIIN_05229 N 0.000
PILCRDRAFT_812601 Piloderma croceum PILCRDRAFT_812601 N 0.000
PISMIDRAFT_251346 Pisolithus microcarpus PISMIDRAFT_251346 N 0.000
PLICRDRAFT_118381 Plicaturopsis crispa PLICRDRAFT_118381 N 0.000
SCHCODRAFT_112581 Schizophyllum commune SCHCODRAFT_112581 N 0.000
SCLCIDRAFT_91585 Scleroderma citrinum SCLCIDRAFT_91585 N 0.000
SERLA73DRAFT_172732 Serpula lacrymans SERLA73DRAFT_172732 N 0.000
V565_097840 Rhizoctonia solani V565_097840 N 0.000