POPTR_0001s24840 (Populus trichocarpa)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 POPTR_0001s24840 T278195_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.979
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.979
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.979
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
POPTR_0001s24840.1 Myb 585 635

Links

Other Myb/SANT family TFs
Other Populus trichocarpa TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
30068.m002544 Ricinus communis 30068.m002544 I 0.000
AMTR_s00024p00250970 Amborella trichopoda AMTR_s00024p00250970 I 0.000
AMTR_s00030p00146410 Amborella trichopoda AMTR_s00030p00146410 I 0.000
AMTR_s00068p00092800 Amborella trichopoda AMTR_s00068p00092800 I 0.000
AMTR_s00068p00097220 Amborella trichopoda AMTR_s00068p00097220 I 0.000
AMTR_s00068p00099460 Amborella trichopoda AMTR_s00068p00099460 I 0.000
AMTR_s00068p00118480 Amborella trichopoda AMTR_s00068p00118480 I 0.000
Aquca_009_00493 Aquilegia coerulea Aquca_009_00493 I 0.000
Aquca_009_00496 Aquilegia coerulea Aquca_009_00496 I 0.000
MYB5 Arabidopsis thaliana AT3G13540 I 0.000
MYB305 Arabidopsis thaliana AT3G24310 I 0.000
ATMYB121 Arabidopsis thaliana AT3G30210 D 0.000
MYB27 Arabidopsis thaliana AT3G53200 D 0.000
AtMYB79 Arabidopsis thaliana AT4G13480 I 0.000
BGIOSGA004260 Oryza indica BGIOSGA004260 I 0.000
BGIOSGA006030 Oryza indica BGIOSGA006030 I 0.000
BGIOSGA014750 Oryza indica BGIOSGA014750 I 0.000
Bo1g098860 Brassica oleracea Bo1g098860 I 0.000
Bo1g138250 Brassica oleracea Bo1g138250 I 0.000
Bo3g083130 Brassica oleracea Bo3g083130 I 0.000
Bo6g067190 Brassica oleracea Bo6g067190 I 0.000
Bo7g033260 Brassica oleracea Bo7g033260 I 0.000
Bo7g088650 Brassica oleracea Bo7g088650 I 0.000
Bo9g009020 Brassica oleracea Bo9g009020 I 0.000
Bostr.0556s0619 Boechera stricta Bostr.0556s0619 I 0.000
Bostr.19424s0195 Boechera stricta Bostr.19424s0195 I 0.000
Bostr.2021s0106 Boechera stricta Bostr.2021s0106 I 0.000
Bostr.3640s0147 Boechera stricta Bostr.3640s0147 I 0.000
Bostr.9544s0002 Boechera stricta Bostr.9544s0002 I 0.000
Bra001941 Brassica rapa Bra001941 I 0.000
Bra015029 Brassica rapa Bra015029 I 0.000
Bra025410 Brassica rapa Bra025410 I 0.000
Bra027423 Brassica rapa Bra027423 I 0.000
Bra028369 Brassica rapa Bra028369 I 0.000
Bra028550 Brassica rapa Bra028550 I 0.000
Bra039395 Brassica rapa Bra039395 I 0.000
BRADI2G47367 Brachypodium distachyon BRADI2G47367 I 0.000
Cagra.0612s0043 Capsella grandiflora Cagra.0612s0043 I 0.000
Cagra.0690s0007 Capsella grandiflora Cagra.0690s0007 I 0.000
Cagra.1138s0003 Capsella grandiflora Cagra.1138s0003 I 0.000
Carubv10014367m.g Capsella rubella Carubv10014367m.g I 0.000
Carubv10014443m.g Capsella rubella Carubv10014443m.g I 0.000
Carubv10018530m.g Capsella rubella Carubv10018530m.g I 0.000
Carubv10019409m.g Capsella rubella Carubv10019409m.g I 0.000
cassava24389.valid.m1 Manihot esculenta cassava24389.valid.m1 I 0.000
cassava24463.valid.m1 Manihot esculenta cassava24463.valid.m1 I 0.000
cassava25868.m1 Manihot esculenta cassava25868.m1 I 0.000
cassava27189.m1 Manihot esculenta cassava27189.m1 I 0.000
cassava28986.valid.m1 Manihot esculenta cassava28986.valid.m1 I 0.000
cassava36364.valid.m1 Manihot esculenta cassava36364.valid.m1 I 0.000
cassava6348.valid.m1 Manihot esculenta cassava6348.valid.m1 I 0.000
cassava9274.m1 Manihot esculenta cassava9274.m1 I 0.000
Ca_01329 Cicer arietinum Ca_01329 I 0.000
Ca_17627 Cicer arietinum Ca_17627 I 0.000
chr1.CM0105.50.nd Lotus japonicus chr1.CM0105.50.nd I 0.000
Ciclev10006914m.g Citrus clementina Ciclev10006914m.g I 0.000
Ciclev10013466m.g Citrus clementina Ciclev10013466m.g I 0.000
Ciclev10015648m.g Citrus clementina Ciclev10015648m.g I 0.000
Ciclev10021571m.g Citrus clementina Ciclev10021571m.g I 0.000
Cla007745 Citrullus lanatus Cla007745 I 0.000
Cla021798 Citrullus lanatus Cla021798 I 0.000
Cucsa.238540 Cucumis sativus Cucsa.238540 I 0.000
Cucsa.255900 Cucumis sativus Cucsa.255900 I 0.000
Cucsa.383230 Cucumis sativus Cucsa.383230 I 0.000
Eucgr.A01648 Eucalyptus grandis Eucgr.A01648 I 0.000
Eucgr.A02110 Eucalyptus grandis Eucgr.A02110 I 0.000
Eucgr.B03606 Eucalyptus grandis Eucgr.B03606 I 0.000
Eucgr.C00826 Eucalyptus grandis Eucgr.C00826 I 0.000
Eucgr.D01701 Eucalyptus grandis Eucgr.D01701 I 0.000
Eucgr.D02390 Eucalyptus grandis Eucgr.D02390 I 0.000
Eucgr.E01031 Eucalyptus grandis Eucgr.E01031 I 0.000
Eucgr.I02057 Eucalyptus grandis Eucgr.I02057 I 0.000
Eucgr.K01504 Eucalyptus grandis Eucgr.K01504 I 0.000
evm.TU.supercontig_119.55 Carica papaya evm.TU.supercontig_119.55 I 0.000
evm.TU.supercontig_49.71 Carica papaya evm.TU.supercontig_49.71 I 0.000
evm.TU.supercontig_51.138 Carica papaya evm.TU.supercontig_51.138 I 0.000
evm.TU.supercontig_51.139 Carica papaya evm.TU.supercontig_51.139 I 0.000
evm.TU.supercontig_59.23 Carica papaya evm.TU.supercontig_59.23 I 0.000
evm.TU.supercontig_92.99 Carica papaya evm.TU.supercontig_92.99 I 0.000
evm.TU.supercontig_96.57 Carica papaya evm.TU.supercontig_96.57 I 0.000
e_gw1.61.201.1 Physcomitrella patens e_gw1.61.201.1 I 0.000
F775_19148 Aegilops tauschii F775_19148 I 0.000
F775_42516 Aegilops tauschii F775_42516 I 0.000
fgenesh2_kg.3__2645__AT3G24310.1 Arabidopsis lyrata fgenesh2_kg.3__2645__AT3G24310.1 I 0.000
AtMYB27 Arabidopsis lyrata fgenesh2_kg.5__1687__AT3G53200.1 I 0.000
ATMYB121 Arabidopsis lyrata fgenesh2_kg.5__710__AT3G30210.1 I 0.000
fgenesh2_kg.9__1__AT4G13480.1 Arabidopsis lyrata fgenesh2_kg.9__1__AT4G13480.1 I 0.000
gene12738-v1.0-hybrid Fragaria vesca gene12738-v1.0-hybrid I 0.000
gene15392-v1.0-hybrid Fragaria vesca gene15392-v1.0-hybrid I 0.000
gene18691-v1.0-hybrid Fragaria vesca gene18691-v1.0-hybrid I 0.000
GLYMA10G26681 Glycine max GLYMA10G26681 I 0.000
GLYMA10G35061 Glycine max GLYMA10G35061 I 0.000
GLYMA13G09980 Glycine max GLYMA13G09980 I 0.000
GLYMA13G16890 Glycine max GLYMA13G16890 I 0.000
GLYMA14G24500 Glycine max GLYMA14G24500 I 0.000
GLYMA17G05831 Glycine max GLYMA17G05831 I 0.000
GLYMA17G17560 Glycine max GLYMA17G17560 I 0.000
GLYMA19G44660 Glycine max GLYMA19G44660 I 0.000
GLYMA20G32500 Glycine max GLYMA20G32500 I 0.000
Gorai.004G130900 Gossypium raimondii Gorai.004G130900 I 0.000
Gorai.004G150800 Gossypium raimondii Gorai.004G150800 I 0.000
Gorai.006G073500 Gossypium raimondii Gorai.006G073500 I 0.000
Gorai.006G254200 Gossypium raimondii Gorai.006G254200 I 0.000
Gorai.007G260600 Gossypium raimondii Gorai.007G260600 I 0.000
Gorai.007G312700 Gossypium raimondii Gorai.007G312700 I 0.000
Gorai.007G350500 Gossypium raimondii Gorai.007G350500 I 0.000
Gorai.008G126700 Gossypium raimondii Gorai.008G126700 I 0.000
Gorai.010G087200 Gossypium raimondii Gorai.010G087200 I 0.000
Gorai.013G114900 Gossypium raimondii Gorai.013G114900 I 0.000
GRMZM2G027697 Zea mays GRMZM2G027697 I 0.000
GRMZM2G395672 Zea mays GRMZM2G395672 I 0.000
GSMUA_Achr10G14030_001 Musa acuminata GSMUA_Achr10G14030_001 I 0.000
GSMUA_Achr1G03450_001 Musa acuminata GSMUA_Achr1G03450_001 I 0.000
GSMUA_Achr3G07950_001 Musa acuminata GSMUA_Achr3G07950_001 I 0.000
GSMUA_Achr5G06530_001 Musa acuminata GSMUA_Achr5G06530_001 I 0.000
GSMUA_Achr6G14840_001 Musa acuminata GSMUA_Achr6G14840_001 I 0.000
GSMUA_Achr7G05570_001 Musa acuminata GSMUA_Achr7G05570_001 I 0.000
GSMUA_Achr7G13700_001 Musa acuminata GSMUA_Achr7G13700_001 I 0.000
GSMUA_Achr8G10800_001 Musa acuminata GSMUA_Achr8G10800_001 I 0.000
LjSGA_023691.1 Lotus japonicus LjSGA_023691.1 I 0.000
LjT20L14.140.nd Lotus japonicus LjT20L14.140.nd I 0.000
LPERR01G23630 Leersia perrieri LPERR01G23630 I 0.000
LPERR04G14700 Leersia perrieri LPERR04G14700 I 0.000
Lus10013762.g Linum usitatissimum Lus10013762.g I 0.000
Lus10023711.g Linum usitatissimum Lus10023711.g I 0.000
Lus10039173.g Linum usitatissimum Lus10039173.g I 0.000
MDP0000140609 Malus domestica MDP0000140609 I 0.000
MDP0000196982 Malus domestica MDP0000196982 I 0.000
MDP0000655330 Malus domestica MDP0000655330 I 0.000
MDP0000723614 Malus domestica MDP0000723614 I 0.000
MDP0000791870 Malus domestica MDP0000791870 I 0.000
MDP0000887107 Malus domestica MDP0000887107 I 0.000
MDP0000915330 Malus domestica MDP0000915330 I 0.000
mgf001865m Mimulus guttatus mgf001865m I 0.000
mgf004640m Mimulus guttatus mgf004640m I 0.000
MLOC_16037 Hordeum vulgare MLOC_16037 I 0.000
MLOC_6786 Hordeum vulgare MLOC_6786 I 0.000
MTR_1g062940 Medicago truncatula MTR_1g062940 N 0.000
MTR_3g083540 Medicago truncatula MTR_3g083540 I 0.000
MTR_7g117730 Medicago truncatula MTR_7g117730 I 0.000
OB01G22230 Oryza brachyantha OB01G22230 I 0.000
OB02G31640 Oryza brachyantha OB02G31640 I 0.000
OB04G25360 Oryza brachyantha OB04G25360 I 0.000
OBART02G24300 Oryza barthii OBART02G24300 I 0.000
OGLUM02G24660 Oryza glumaepatula OGLUM02G24660 I 0.000
OLONG_002608 Oryza longistaminata OLONG_002608 I 0.000
OMERI02G23750 Oryza meridionalis OMERI02G23750 I 0.000
ONIVA09G12460 Oryza nivara ONIVA09G12460 I 0.000
OPUNC02G22200 Oryza punctata OPUNC02G22200 I 0.000
orange1.1g036215m.g Citrus sinensis orange1.1g036215m.g I 0.000
orange1.1g040726m.g Citrus sinensis orange1.1g040726m.g I 0.000
orange1.1g040841m.g Citrus sinensis orange1.1g040841m.g I 0.000
orange1.1g047839m.g Citrus sinensis orange1.1g047839m.g I 0.000
orange1.1g047854m.g Citrus sinensis orange1.1g047854m.g I 0.000
ORGLA01G0227100 Oryza glaberrima ORGLA01G0227100 I 0.000
ORGLA02G0210000 Oryza glaberrima ORGLA02G0210000 I 0.000
ORGLA04G0153500 Oryza glaberrima ORGLA04G0153500 I 0.000
ORUFI01G30610 Oryza rufipogon ORUFI01G30610 I 0.000
ORUFI02G25650 Oryza rufipogon ORUFI02G25650 I 0.000
ORUFI04G19690 Oryza rufipogon ORUFI04G19690 I 0.000
OS01G0695900 Oryza sativa OS01G0695900 I 0.000
OS02G0618400 Oryza sativa OS02G0618400 I 0.000
OS04G0508500 Oryza sativa OS04G0508500 I 0.000
Pavir.Aa01294 Panicum virgatum Pavir.Aa01294 I 0.000
Pavir.Ga01308 Panicum virgatum Pavir.Ga01308 I 0.000
Pavir.J31180 Panicum virgatum Pavir.J31180 I 0.000
Pavir.J37992 Panicum virgatum Pavir.J37992 I 0.000
PDK_20s1310471g002 Phoenix dactylifera PDK_20s1310471g002 I 0.000
PGSC0003DMG400001376 Solanum tuberosum PGSC0003DMG400001376 I 0.000
PK13689.1 Cannabis sativa PK13689.1 I 0.000
PK14784.1 Cannabis sativa PK14784.1 I 0.000
Pm009050 Prunus mume Pm009050 I 0.000
Pm015392 Prunus mume Pm015392 I 0.000
Pm018338 Prunus mume Pm018338 I 0.000
Pm027048 Prunus mume Pm027048 I 0.000
POPTR_0001s04240 Populus trichocarpa POPTR_0001s04240 I 0.000
POPTR_0001s11100 Populus trichocarpa POPTR_0001s11100 I 0.000
POPTR_0003s14420 Populus trichocarpa POPTR_0003s14420 I 0.000
POPTR_0003s21120 Populus trichocarpa POPTR_0003s21120 I 0.000
POPTR_0012s05200 Populus trichocarpa POPTR_0012s05200 I 0.000
POPTR_0013s05300 Populus trichocarpa POPTR_0013s05300 I 0.000
POPTR_0013s05310 Populus trichocarpa POPTR_0013s05310 I 0.000
POPTR_0015s03770 Populus trichocarpa POPTR_0015s03770 I 0.000
POPTR_0019s05190 Populus trichocarpa POPTR_0019s05190 I 0.000
POPTR_0019s05200 Populus trichocarpa POPTR_0019s05200 I 0.000
POPTR_0019s05210 Populus trichocarpa POPTR_0019s05210 I 0.000
PRUPE_ppa006730mg Prunus persica PRUPE_ppa006730mg I 0.000
PRUPE_ppa009439mg Prunus persica PRUPE_ppa009439mg I 0.000
PRUPE_ppa016385mg Prunus persica PRUPE_ppa016385mg I 0.000
PRUPE_ppa017136mg Prunus persica PRUPE_ppa017136mg I 0.000
PRUPE_ppa024234mg Prunus persica PRUPE_ppa024234mg I 0.000
Q2TCH0_PETHY Petunia x hybrida Q2TCH0_PETHY D 0.000
SapurV1A.0059s0150 Salix purpurea SapurV1A.0059s0150 I 0.000
SapurV1A.0059s0160 Salix purpurea SapurV1A.0059s0160 I 0.000
SapurV1A.0081s0400 Salix purpurea SapurV1A.0081s0400 I 0.000
SapurV1A.0530s0020 Salix purpurea SapurV1A.0530s0020 I 0.000
SapurV1A.0553s0100 Salix purpurea SapurV1A.0553s0100 I 0.000
SapurV1A.0553s0110 Salix purpurea SapurV1A.0553s0110 I 0.000
SapurV1A.0598s0010 Salix purpurea SapurV1A.0598s0010 I 0.000
SapurV1A.0918s0130 Salix purpurea SapurV1A.0918s0130 I 0.000
SapurV1A.0989s0120 Salix purpurea SapurV1A.0989s0120 I 0.000
SapurV1A.1276s0050 Salix purpurea SapurV1A.1276s0050 I 0.000
SapurV1A.1276s0060 Salix purpurea SapurV1A.1276s0060 I 0.000
SapurV1A.1621s0010 Salix purpurea SapurV1A.1621s0010 I 0.000
SapurV1A.2885s0020 Salix purpurea SapurV1A.2885s0020 I 0.000
Sb04g026210 Sorghum bicolor Sb04g026210 I 0.000
ATMYB5 Arabidopsis lyrata scaffold_301556.1 I 0.000
Si004316m.g Setaria italica Si004316m.g I 0.000
Si010822m.g Setaria italica Si010822m.g I 0.000
Si018007m.g Setaria italica Si018007m.g I 0.000
Solyc01g005660.1 Solanum lycopersicum Solyc01g005660.1 I 0.000
Solyc02g089190.1 Solanum lycopersicum Solyc02g089190.1 I 0.000
TCM_012363 Theobroma cacao TCM_012363 I 0.000
TCM_015685 Theobroma cacao TCM_015685 I 0.000
TCM_018971 Theobroma cacao TCM_018971 I 0.000
TCM_021037 Theobroma cacao TCM_021037 I 0.000
TCM_024180 Theobroma cacao TCM_024180 I 0.000
TCM_025910 Theobroma cacao TCM_025910 I 0.000
TCM_037377 Theobroma cacao TCM_037377 I 0.000
Thhalv10002634m.g Eutrema salsugineum Thhalv10002634m.g I 0.000
Thhalv10005370m.g Eutrema salsugineum Thhalv10005370m.g I 0.000
Thhalv10010915m.g Eutrema salsugineum Thhalv10010915m.g I 0.000
Thhalv10022057m.g Eutrema salsugineum Thhalv10022057m.g I 0.000
TRAES3BF026500080CFD_g Triticum aestivum TRAES3BF026500080CFD_g I 0.000
Traes_4DL_26A958CDD Triticum aestivum Traes_4DL_26A958CDD I 0.000
Traes_6BL_8E4A831B6 Triticum aestivum Traes_6BL_8E4A831B6 I 0.000
VIT_05s0049g02260 Vitis vinifera VIT_05s0049g02260 I 0.000
VIT_06s0004g00570 Vitis vinifera VIT_06s0004g00570 I 0.000
VIT_08s0007g07230 Vitis vinifera VIT_08s0007g07230 I 0.000
VIT_11s0016g01300 Vitis vinifera VIT_11s0016g01300 I 0.000
VIT_15s0046g00170 Vitis vinifera VIT_15s0046g00170 I 0.000