Si016548m.g (Setaria italica)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 Si016548m.g T279788_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.936
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.936
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Si016548m Myb 577 627

Links

Other Myb/SANT family TFs
Other Setaria italica TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AAA49743 Xenopus laevis AAA49743 I 0.000
AAA49748 Xenopus laevis AAA49748 I 0.000
AAB71818 Xenopus laevis AAB71818 I 0.000
AAEL008466 Aedes aegypti AAEL008466 I 0.000
AAEL009742 Aedes aegypti AAEL009742 I 0.000
AAEL012881 Aedes aegypti AAEL012881 I 0.000
AAEL013405 Aedes aegypti AAEL013405 I 0.000
AAEL013832 Aedes aegypti AAEL013832 I 0.000
AALB007457 Anopheles albimanus AALB007457 I 0.000
Aan_R001086 Calypte anna Aan_R001086 I 0.000
Aan_R009428 Calypte anna Aan_R009428 I 0.000
Aan_R012458 Calypte anna Aan_R012458 I 0.000
Aan_R014655 Calypte anna Aan_R014655 I 0.000
AARA000396 Anopheles arabiensis AARA000396 I 0.000
AARA001041 Anopheles arabiensis AARA001041 I 0.000
AATE011248 Anopheles atroparvus AATE011248 I 0.000
AATE013980 Anopheles atroparvus AATE013980 I 0.000
AATE014015 Anopheles atroparvus AATE014015 I 0.000
AATE016576 Anopheles atroparvus AATE016576 I 0.000
ACAC_0000013301 Angiostrongylus cantonensis ACAC_0000013301 I 0.000
ACAC_0000231501 Angiostrongylus cantonensis ACAC_0000231501 I 0.000
ACAC_0000599901 Angiostrongylus cantonensis ACAC_0000599901 I 0.000
ACEP10426 Atta cephalotes ACEP10426 I 0.000
ACEP10429 Atta cephalotes ACEP10429 I 0.000
ACEP19392 Atta cephalotes ACEP19392 I 0.000
ACEP24978 Atta cephalotes ACEP24978 I 0.000
ACHR000192 Anopheles christyi ACHR000192 I 0.000
ACHR000617 Anopheles christyi ACHR000617 I 0.000
ACHR004580 Anopheles christyi ACHR004580 I 0.000
ACOC_0000039401 Angiostrongylus costaricensis ACOC_0000039401 I 0.000
ACOC_0001051501 Angiostrongylus costaricensis ACOC_0001051501 I 0.000
ACOM028035 Anopheles coluzzii ACOM028035 I 0.000
ACOM031146 Anopheles coluzzii ACOM031146 I 0.000
ACOM036180 Anopheles coluzzii ACOM036180 I 0.000
ACUA000021 Anopheles culicifacies ACUA000021 I 0.000
ACUA007355 Anopheles culicifacies ACUA007355 I 0.000
ACUA010574 Anopheles culicifacies ACUA010574 I 0.000
ACYPI001856 Acyrthosiphon pisum ACYPI001856 I 0.000
ACYPI008295 Acyrthosiphon pisum ACYPI008295 I 0.000
ACYPI009147 Acyrthosiphon pisum ACYPI009147 I 0.000
ACYPI29629 Acyrthosiphon pisum ACYPI29629 I 0.000
ACYPI42210 Acyrthosiphon pisum ACYPI42210 I 0.000
ACYPI42465 Acyrthosiphon pisum ACYPI42465 I 0.000
ADAC000511 Anopheles darlingi ADAC000511 I 0.000
ADAC000706 Anopheles darlingi ADAC000706 I 0.000
ADAC010621 Anopheles darlingi ADAC010621 I 0.000
ADIR001372 Anopheles dirus ADIR001372 I 0.000
ADIR004637 Anopheles dirus ADIR004637 I 0.000
ADIR009073 Anopheles dirus ADIR009073 I 0.000
ADIR009075 Anopheles dirus ADIR009075 I 0.000
ADIR009852 Anopheles dirus ADIR009852 I 0.000
AEPI009372 Anopheles epiroticus AEPI009372 I 0.000
AFAF006972 Anopheles farauti AFAF006972 I 0.000
AFAF011982 Anopheles farauti AFAF011982 I 0.000
AFAF019137 Anopheles farauti AFAF019137 I 0.000
AFAF020319 Anopheles farauti AFAF020319 I 0.000
Afo_R003397 Aptenodytes forsteri Afo_R003397 I 0.000
Afo_R003421 Aptenodytes forsteri Afo_R003421 I 0.000
Afo_R006604 Aptenodytes forsteri Afo_R006604 I 0.000
Afo_R006933 Aptenodytes forsteri Afo_R006933 I 0.000
AFUN006868 Anopheles funestus AFUN006868 I 0.000
AFUN006870 Anopheles funestus AFUN006870 I 0.000
AFUN008166 Anopheles funestus AFUN008166 I 0.000
AGAP000484 Anopheles gambiae AGAP000484 I 0.000
AGAP004661 Anopheles gambiae AGAP004661 I 0.000
AGAP004662 Anopheles gambiae AGAP004662 I 0.000
AGAP012428 Anopheles gambiae AGAP012428 I 0.000
AGAP013373 Anopheles gambiae AGAP013373 I 0.000
Alligator_sinensis_CCG005137.1 Alligator sinensis Alligator_sinensis_CCG005137.1 I 0.000
Alligator_sinensis_CCG005138.1 Alligator sinensis Alligator_sinensis_CCG005138.1 I 0.000
Alligator_sinensis_CCG010191.1 Alligator sinensis Alligator_sinensis_CCG010191.1 I 0.000
Alligator_sinensis_CCG014472.1 Alligator sinensis Alligator_sinensis_CCG014472.1 I 0.000
Alligator_sinensis_CCG014472.2 Alligator sinensis Alligator_sinensis_CCG014472.2 I 0.000
Alligator_sinensis_CCG014474.1 Alligator sinensis Alligator_sinensis_CCG014474.1 I 0.000
ALUE_0000444101 Ascaris lumbricoides ALUE_0000444101 I 0.000
ALUE_0001139201 Ascaris lumbricoides ALUE_0001139201 I 0.000
ALUE_0001256301 Ascaris lumbricoides ALUE_0001256301 I 0.000
AMAM001814 Anopheles maculatus AMAM001814 I 0.000
AMAM002926 Anopheles maculatus AMAM002926 I 0.000
AMAM005972 Anopheles maculatus AMAM005972 I 0.000
AMAM008554 Anopheles maculatus AMAM008554 I 0.000
AMEC008960 Anopheles melas AMEC008960 I 0.000
AMEC018527 Anopheles melas AMEC018527 I 0.000
AMEM012771 Anopheles merus AMEM012771 I 0.000
AMEM012865 Anopheles merus AMEM012865 I 0.000
AMEM017086 Anopheles merus AMEM017086 I 0.000
AMIN000116 Anopheles minimus AMIN000116 I 0.000
AMIN005093 Anopheles minimus AMIN005093 I 0.000
AMIN005226 Anopheles minimus AMIN005226 I 0.000
AMIN005791 Anopheles minimus AMIN005791 I 0.000
AMIN007516 Anopheles minimus AMIN007516 I 0.000
ANCCAN_00182 Ancylostoma caninum ANCCAN_00182 I 0.000
ANCCAN_01055 Ancylostoma caninum ANCCAN_01055 I 0.000
ANCCAN_19207 Ancylostoma caninum ANCCAN_19207 I 0.000
ANCCEY_04147 Ancylostoma ceylanicum ANCCEY_04147 I 0.000
ANCCEY_06601 Ancylostoma ceylanicum ANCCEY_06601 I 0.000
ANCCEY_08001 Ancylostoma ceylanicum ANCCEY_08001 I 0.000
ANCCEY_11472 Ancylostoma ceylanicum ANCCEY_11472 I 0.000
ANCCEY_13266 Ancylostoma ceylanicum ANCCEY_13266 I 0.000
ANCDUO_14360 Ancylostoma duodenale ANCDUO_14360 I 0.000
ANCDUO_22332 Ancylostoma duodenale ANCDUO_22332 I 0.000
ANCDUO_22333 Ancylostoma duodenale ANCDUO_22333 I 0.000
ANCDUO_24943 Ancylostoma duodenale ANCDUO_24943 I 0.000
Aqu1.222534 Amphimedon queenslandica Aqu1.222534 I 0.000
AQUA002501 Anopheles quadriannulatus AQUA002501 I 0.000
AQUA008031 Anopheles quadriannulatus AQUA008031 I 0.000
ASIM_0001529401 Anisakis simplex ASIM_0001529401 I 0.000
ASIS001395 Anopheles sinensis ASIS001395 I 0.000
ASIS003175 Anopheles sinensis ASIS003175 I 0.000
ASIS011532 Anopheles sinensis ASIS011532 I 0.000
ASTEI04487 Anopheles stephensi ASTEI04487 I 0.000
ASTEI06920 Anopheles stephensi ASTEI06920 I 0.000
ASTEI06922 Anopheles stephensi ASTEI06922 I 0.000
ASTEI09804 Anopheles stephensi ASTEI09804 I 0.000
ASU_00194 Ascaris suum ASU_00194 I 0.000
ASU_03565 Ascaris suum ASU_03565 I 0.000
ASU_03570 Ascaris suum ASU_03570 I 0.000
ASU_04337 Ascaris suum ASU_04337 I 0.000
ASU_06874 Ascaris suum ASU_06874 I 0.000
A_00307 Schistosoma haematobium A_00307 I 0.000
A_01388 Schistosoma haematobium A_01388 I 0.000
A_02101 Schistosoma haematobium A_02101 I 0.000
A_07224 Schistosoma haematobium A_07224 I 0.000
BGIBMGA006388 Bombyx mori BGIBMGA006388 I 0.000
BGIBMGA007623 Bombyx mori BGIBMGA007623 I 0.000
BGIBMGA010833 Bombyx mori BGIBMGA010833 I 0.000
BGIBMGA012499 Bombyx mori BGIBMGA012499 I 0.000
BGLB009369 Biomphalaria glabrata BGLB009369 I 0.000
Bm2071 Brugia malayi Bm2071 I 0.000
Brh_R009844 Buceros rhinoceros Brh_R009844 I 0.000
BXY_1152800 Bursaphelenchus xylophilus BXY_1152800 I 0.000
BXY_1246700 Bursaphelenchus xylophilus BXY_1246700 I 0.000
CapteG127720 Capitella teleta CapteG127720 I 0.000
CapteG174957 Capitella teleta CapteG174957 I 0.000
CapteG225442 Capitella teleta CapteG225442 I 0.000
CapteG30886 Capitella teleta CapteG30886 I 0.000
CapteG78648 Capitella teleta CapteG78648 I 0.000
CapteG94902 Capitella teleta CapteG94902 I 0.000
CBG14125 Caenorhabditis briggsae CBG14125 I 0.000
CBG14126 Caenorhabditis briggsae CBG14126 I 0.000
CBG14514 Caenorhabditis briggsae CBG14514 I 0.000
CBG17719 Caenorhabditis briggsae CBG17719 I 0.000
CBG23031 Caenorhabditis briggsae CBG23031 D 0.000
CBN06277 Caenorhabditis brenneri CBN06277 I 0.000
CBN14347 Caenorhabditis brenneri CBN14347 I 0.000
CBN14959 Caenorhabditis brenneri CBN14959 I 0.000
CBN16705 Caenorhabditis brenneri CBN16705 I 0.000
CBN19084 Caenorhabditis brenneri CBN19084 I 0.000
Cflo_00844--XP_394120.3_APIME Camponotus floridanus Cflo_00844--XP_394120.3_APIME I 0.000
Cflo_00848--XP_623989.2_APIME Camponotus floridanus Cflo_00848--XP_623989.2_APIME I 0.000
Cflo_01350--XP_001122544.1_APIME Camponotus floridanus Cflo_01350--XP_001122544.1_APIME I 0.000
Cflo_08609--XP_001121415.1_APIME Camponotus floridanus Cflo_08609--XP_001121415.1_APIME I 0.000
Cflo_13663--XP_396835.3_APIME Camponotus floridanus Cflo_13663--XP_396835.3_APIME I 0.000
CGI_10009941 Crassostrea gigas CGI_10009941 I 0.000
CGI_10018592 Crassostrea gigas CGI_10018592 I 0.000
CGI_10025189 Crassostrea gigas CGI_10025189 I 0.000
CGI_10026562 Crassostrea gigas CGI_10026562 I 0.000
CGOC_0000625601 Cylicostephanus goldi CGOC_0000625601 I 0.000
CJA07158 Caenorhabditis japonica CJA07158 I 0.000
CJA07729 Caenorhabditis japonica CJA07729 I 0.000
CJA13317 Caenorhabditis japonica CJA13317 I 0.000
CJA14076 Caenorhabditis japonica CJA14076 I 0.000
CJA14652 Caenorhabditis japonica CJA14652 I 0.000
CJA38853 Caenorhabditis japonica CJA38853 I 0.000
CLEC002808 Cimex lectularius CLEC002808 I 0.000
CLEC002972 Cimex lectularius CLEC002972 I 0.000
CLEC025113 Cimex lectularius CLEC025113 I 0.000
CLEC025236 Cimex lectularius CLEC025236 I 0.000
Cmyd_10006889 Chelonia mydas Cmyd_10006889 I 0.000
Cmyd_10014636 Chelonia mydas Cmyd_10014636 I 0.000
Cmyd_10015815 Chelonia mydas Cmyd_10015815 I 0.000
Cmyd_10015817 Chelonia mydas Cmyd_10015817 I 0.000
CPIJ001011 Culex quinquefasciatus CPIJ001011 I 0.000
CPIJ001016 Culex quinquefasciatus CPIJ001016 I 0.000
CPIJ011541 Culex quinquefasciatus CPIJ011541 I 0.000
CPIJ019260 Culex quinquefasciatus CPIJ019260 I 0.000
CpipJ_CPIJ001011 Culex pipiens CpipJ_CPIJ001011 I 0.000
CpipJ_CPIJ001016 Culex pipiens CpipJ_CPIJ001016 I 0.000
CpipJ_CPIJ011541 Culex pipiens CpipJ_CPIJ011541 I 0.000
CpipJ_CPIJ019260 Culex pipiens CpipJ_CPIJ019260 I 0.000
CRE00302 Caenorhabditis remanei CRE00302 I 0.000
CRE00442 Caenorhabditis remanei CRE00442 I 0.000
CRE00924 Caenorhabditis remanei CRE00924 I 0.000
CRE24471 Caenorhabditis remanei CRE24471 I 0.000
CRE27973 Caenorhabditis remanei CRE27973 I 0.000
csin101844 Clonorchis sinensis csin101844 I 0.000
csin105925 Clonorchis sinensis csin105925 I 0.000
csin106332 Clonorchis sinensis csin106332 I 0.000
csin111688 Clonorchis sinensis csin111688 I 0.000
D915_05782 Fasciola hepatica D915_05782 I 0.000
D915_06872 Fasciola hepatica D915_06872 I 0.000
D915_08011 Fasciola hepatica D915_08011 I 0.000
D915_10178 Fasciola hepatica D915_10178 I 0.000
D915_10792 Fasciola hepatica D915_10792 I 0.000
D917_01694 Trichinella nativa D917_01694 I 0.000
D917_01700 Trichinella nativa D917_01700 I 0.000
D917_09006 Trichinella nativa D917_09006 I 0.000
D918_07111 Trichuris suis D918_07111 I 0.000
D918_08493 Trichuris suis D918_08493 I 0.000
D918_08494 Trichuris suis D918_08494 I 0.000
DAPPUDRAFT_17940 Daphnia pulex DAPPUDRAFT_17940 I 0.000
DAPPUDRAFT_18657 Daphnia pulex DAPPUDRAFT_18657 I 0.000
DAPPUDRAFT_28734 Daphnia pulex DAPPUDRAFT_28734 I 0.000
DAPPUDRAFT_29136 Daphnia pulex DAPPUDRAFT_29136 I 0.000
DAPPUDRAFT_347209 Daphnia pulex DAPPUDRAFT_347209 I 0.000
DAPPUDRAFT_347228 Daphnia pulex DAPPUDRAFT_347228 I 0.000
DAPPUDRAFT_55072 Daphnia pulex DAPPUDRAFT_55072 I 0.000
DICVIV_05947 Dictyocaulus viviparus DICVIV_05947 I 0.000
DICVIV_09301 Dictyocaulus viviparus DICVIV_09301 I 0.000
DICVIV_12881 Dictyocaulus viviparus DICVIV_12881 I 0.000
DICVIV_13052 Dictyocaulus viviparus DICVIV_13052 I 0.000
DILT_0000701601 Diphyllobothrium latum DILT_0000701601 I 0.000
DILT_0000810401 Diphyllobothrium latum DILT_0000810401 I 0.000
DILT_0001041601 Diphyllobothrium latum DILT_0001041601 I 0.000
DME_0000192101 Dracunculus medinensis DME_0000192101 I 0.000
DME_0000451901 Dracunculus medinensis DME_0000451901 I 0.000
ECANG7_06029 Echinococcus canadensis ECANG7_06029 I 0.000
ECANG7_06690 Echinococcus canadensis ECANG7_06690 I 0.000
ECANG7_06820 Echinococcus canadensis ECANG7_06820 I 0.000
ECANG7_06896 Echinococcus canadensis ECANG7_06896 I 0.000
ECPE_0000255201 Echinostoma caproni ECPE_0000255201 I 0.000
ECPE_0000345701 Echinostoma caproni ECPE_0000345701 I 0.000
ECPE_0000365201 Echinostoma caproni ECPE_0000365201 I 0.000
EEL_0000489101 Elaeophora elaphi EEL_0000489101 I 0.000
EFV59753 Trichinella spiralis EFV59753 I 0.000
EmuJ_000444300 Echinococcus multilocularis EmuJ_000444300 I 0.000
EmuJ_000824700 Echinococcus multilocularis EmuJ_000824700 I 0.000
EmuJ_000867900 Echinococcus multilocularis EmuJ_000867900 I 0.000
EmuJ_000959500 Echinococcus multilocularis EmuJ_000959500 I 0.000
EmuJ_001116800 Echinococcus multilocularis EmuJ_001116800 I 0.000
ENSACAG00000004936 Anolis carolinensis ENSACAG00000004936 I 0.000
HOXB8 Anolis carolinensis ENSACAG00000006423 I 0.000
HOXB6 Anolis carolinensis ENSACAG00000006474 I 0.000
HOXC8 Anolis carolinensis ENSACAG00000010906 I 0.000
HOXC6 Anolis carolinensis ENSACAG00000010917 I 0.000
ENSACAG00000017909 Anolis carolinensis ENSACAG00000017909 I 0.000
NKX1-2 Anolis carolinensis ENSACAG00000022361 I 0.000
ENSAMEG00000000683 Ailuropoda melanoleuca ENSAMEG00000000683 I 0.000
ENSAMEG00000000686 Ailuropoda melanoleuca ENSAMEG00000000686 I 0.000
ENSAMEG00000001838 Ailuropoda melanoleuca ENSAMEG00000001838 I 0.000
ENSAMEG00000004111 Ailuropoda melanoleuca ENSAMEG00000004111 I 0.000
ENSAMEG00000004971 Ailuropoda melanoleuca ENSAMEG00000004971 I 0.000
ENSAMEG00000004982 Ailuropoda melanoleuca ENSAMEG00000004982 I 0.000
ENSAMEG00000005892 Ailuropoda melanoleuca ENSAMEG00000005892 I 0.000
ENSAMEG00000008660 Ailuropoda melanoleuca ENSAMEG00000008660 I 0.000
ENSAMXG00000002210 Astyanax mexicanus ENSAMXG00000002210 I 0.000
ENSAMXG00000006910 Astyanax mexicanus ENSAMXG00000006910 I 0.000
ENSAMXG00000008966 Astyanax mexicanus ENSAMXG00000008966 I 0.000
ENSAMXG00000009389 Astyanax mexicanus ENSAMXG00000009389 I 0.000
ENSAMXG00000009393 Astyanax mexicanus ENSAMXG00000009393 I 0.000
ENSAMXG00000009666 Astyanax mexicanus ENSAMXG00000009666 I 0.000
ENSAMXG00000010392 Astyanax mexicanus ENSAMXG00000010392 I 0.000
ENSAMXG00000015975 Astyanax mexicanus ENSAMXG00000015975 I 0.000
ENSAMXG00000015991 Astyanax mexicanus ENSAMXG00000015991 I 0.000
ENSAMXG00000016684 Astyanax mexicanus ENSAMXG00000016684 I 0.000
ENSAMXG00000024680 Astyanax mexicanus ENSAMXG00000024680 I 0.000
ENSAMXG00000024681 Astyanax mexicanus ENSAMXG00000024681 I 0.000
ENSAPLG00000008959 Anas platyrhynchos ENSAPLG00000008959 I 0.000
ENSAPLG00000011211 Anas platyrhynchos ENSAPLG00000011211 I 0.000
ENSAPLG00000013614 Anas platyrhynchos ENSAPLG00000013614 I 0.000
ENSAPLG00000013649 Anas platyrhynchos ENSAPLG00000013649 I 0.000
BARHL2 Bos taurus ENSBTAG00000005938 I 0.000
HOXC6 Bos taurus ENSBTAG00000009238 I 0.000
HOXC8 Bos taurus ENSBTAG00000012149 I 0.000
NKX1-2 Bos taurus ENSBTAG00000020918 I 0.000
BARHL1 Bos taurus ENSBTAG00000023801 I 0.000
HOXA6 Bos taurus ENSBTAG00000024341 I 0.000
ENSBTAP00000007796-D1 Bos grunniens ENSBTAP00000007796-D1 I 0.000
ENSBTAP00000032586-D1 Bos grunniens ENSBTAP00000032586-D1 I 0.000
HOXA6 Canis familiaris ENSCAFG00000002953 I 0.000
HOXC6 Canis familiaris ENSCAFG00000006622 I 0.000
HOXD8 Canis familiaris ENSCAFG00000013450 I 0.000
HOXB6 Canis familiaris ENSCAFG00000016854 I 0.000
HOXB8 Canis familiaris ENSCAFG00000016860 I 0.000
BARHL1 Canis familiaris ENSCAFG00000019892 I 0.000
BARHL2 Canis familiaris ENSCAFG00000020194 I 0.000
NKX1-1 Canis familiaris ENSCAFG00000031073 I 0.000
NKX1-2 Canis familiaris ENSCAFG00000031292 I 0.000
ENSCAFG00000032625 Canis familiaris ENSCAFG00000032625 I 0.000
HOXA6 Choloepus hoffmanni ENSCHOG00000009037 I 0.000
hox13 Ciona intestinalis ENSCING00000019710 I 0.000
ENSCING00000023524 Ciona intestinalis ENSCING00000023524 I 0.000
BARHL2 Callithrix jacchus ENSCJAG00000001885 I 0.000
HOXB8 Callithrix jacchus ENSCJAG00000007454 I 0.000
HOXB6 Callithrix jacchus ENSCJAG00000007467 I 0.000
HOXA6 Callithrix jacchus ENSCJAG00000008082 I 0.000
HOXD8 Callithrix jacchus ENSCJAG00000008284 I 0.000
BARHL1 Callithrix jacchus ENSCJAG00000018212 I 0.000
HOXC8 Callithrix jacchus ENSCJAG00000018828 I 0.000
HOXC6 Callithrix jacchus ENSCJAG00000018835 I 0.000
ENSCPOG00000009444 Cavia porcellus ENSCPOG00000009444 I 0.000
HOXD8 Cavia porcellus ENSCPOG00000015005 I 0.000
BARHL2 Cavia porcellus ENSCPOG00000019619 I 0.000
ENSCPOG00000020512 Cavia porcellus ENSCPOG00000020512 I 0.000
ENSCPOG00000020838 Cavia porcellus ENSCPOG00000020838 I 0.000
ENSCPOG00000021447 Cavia porcellus ENSCPOG00000021447 I 0.000
ENSCPOG00000024489 Cavia porcellus ENSCPOG00000024489 I 0.000
BARHL1 Cavia porcellus ENSCPOG00000025325 I 0.000
ENSCSAG00000001457 Chlorocebus sabaeus ENSCSAG00000001457 I 0.000
ENSCSAG00000002523 Chlorocebus sabaeus ENSCSAG00000002523 I 0.000
ENSCSAG00000002526 Chlorocebus sabaeus ENSCSAG00000002526 I 0.000
ENSCSAG00000004528 Chlorocebus sabaeus ENSCSAG00000004528 I 0.000
ENSCSAG00000005449 Chlorocebus sabaeus ENSCSAG00000005449 I 0.000
ENSCSAG00000005451 Chlorocebus sabaeus ENSCSAG00000005451 I 0.000
ENSCSAG00000014287 Chlorocebus sabaeus ENSCSAG00000014287 I 0.000
ENSCSAG00000014437 Chlorocebus sabaeus ENSCSAG00000014437 I 0.000
ENSCSAG00000014946 Chlorocebus sabaeus ENSCSAG00000014946 I 0.000
ENSCSAG00000015596 Chlorocebus sabaeus ENSCSAG00000015596 I 0.000
ENSCSAVG00000011287 Ciona savignyi ENSCSAVG00000011287 I 0.000
nkx1.2la Danio rerio ENSDARG00000006350 I 0.000
hoxb6a Danio rerio ENSDARG00000010630 I 0.000
barhl1b Danio rerio ENSDARG00000019013 I 0.000
pnx Danio rerio ENSDARG00000025899 I 0.000
hoxb6b Danio rerio ENSDARG00000026513 I 0.000
barhl1a Danio rerio ENSDARG00000035508 I 0.000
hoxb8b Danio rerio ENSDARG00000054025 I 0.000
hoxb8a Danio rerio ENSDARG00000056027 I 0.000
hoxc6a Danio rerio ENSDARG00000070343 I 0.000
hoxc8a Danio rerio ENSDARG00000070346 I 0.000
nkx1.2lb Danio rerio ENSDARG00000099427 I 0.000
hoxc6b Danio rerio ENSDARG00000101954 I 0.000
barhl2 Danio rerio ENSDARG00000104361 I 0.000
HOXA6 Dasypus novemcinctus ENSDNOG00000001633 I 0.000
BARHL1 Dasypus novemcinctus ENSDNOG00000005808 I 0.000
HOXD8 Dasypus novemcinctus ENSDNOG00000008112 I 0.000
BARHL2 Dasypus novemcinctus ENSDNOG00000033457 I 0.000
HOXC8 Dasypus novemcinctus ENSDNOG00000034735 I 0.000
ENSDNOG00000036145 Dasypus novemcinctus ENSDNOG00000036145 I 0.000
ENSDNOG00000036594 Dasypus novemcinctus ENSDNOG00000036594 I 0.000
Hoxa6 Dipodomys ordii ENSDORG00000006319 I 0.000
ENSDORG00000006996 Dipodomys ordii ENSDORG00000006996 I 0.000
ENSDORG00000006998 Dipodomys ordii ENSDORG00000006998 I 0.000
Barhl2 Dipodomys ordii ENSDORG00000011499 I 0.000
HOXA6 Equus caballus ENSECAG00000000575 I 0.000
ENSECAG00000000932 Equus caballus ENSECAG00000000932 I 0.000
HOXC6 Equus caballus ENSECAG00000003682 I 0.000
BARHL2 Equus caballus ENSECAG00000010403 I 0.000
HOXB6 Equus caballus ENSECAG00000012850 I 0.000
BARHL1 Equus caballus ENSECAG00000021032 I 0.000
HOXD8 Equus caballus ENSECAG00000021980 I 0.000
HOXC6 Erinaceus europaeus ENSEEUG00000010293 I 0.000
HOXD8 Echinops telfairi ENSETEG00000011076 I 0.000
HOXC6 Echinops telfairi ENSETEG00000015765 I 0.000
HOXB6 Echinops telfairi ENSETEG00000019370 I 0.000
ENSFALG00000000252 Ficedula albicollis ENSFALG00000000252 I 0.000
ENSFALG00000001467 Ficedula albicollis ENSFALG00000001467 I 0.000
ENSFALG00000001803 Ficedula albicollis ENSFALG00000001803 I 0.000
ENSFALG00000003158 Ficedula albicollis ENSFALG00000003158 I 0.000
ENSFALG00000004783 Ficedula albicollis ENSFALG00000004783 I 0.000
ENSFALG00000009450 Ficedula albicollis ENSFALG00000009450 I 0.000
ENSFALG00000014224 Ficedula albicollis ENSFALG00000014224 I 0.000
HOXB6 Felis catus ENSFCAG00000002114 I 0.000
HOXC8 Felis catus ENSFCAG00000004769 I 0.000
HOXC6 Felis catus ENSFCAG00000011201 I 0.000
ENSFCAG00000023730 Felis catus ENSFCAG00000023730 I 0.000
HOXA6 Felis catus ENSFCAG00000027995 I 0.000
BARHL2 Felis catus ENSFCAG00000029532 I 0.000
HOXC8 Homo sapiens ENSG00000037965 D 0.000
HOXA6 Homo sapiens ENSG00000106006 D 0.000
HOXB6 Homo sapiens ENSG00000108511 D 0.000
HOXB8 Homo sapiens ENSG00000120068 D 0.000
BARHL1 Homo sapiens ENSG00000125492 D 0.000
BARHL2 Homo sapiens ENSG00000143032 D 0.000
HOXD8 Homo sapiens ENSG00000175879 D 0.000
HOXC6 Homo sapiens ENSG00000197757 I 0.000
NKX1-2 Homo sapiens ENSG00000229544 I 0.000
NKX1-1 Homo sapiens ENSG00000235608 I 0.000
ENSGACG00000000154 Gasterosteus aculeatus ENSGACG00000000154 I 0.000
barhl2 Gasterosteus aculeatus ENSGACG00000004346 I 0.000
ENSGACG00000005623 Gasterosteus aculeatus ENSGACG00000005623 I 0.000
hoxc8a Gasterosteus aculeatus ENSGACG00000009401 I 0.000
hoxc6a Gasterosteus aculeatus ENSGACG00000009405 I 0.000
nkx1.2la Gasterosteus aculeatus ENSGACG00000009698 I 0.000
barhl1a Gasterosteus aculeatus ENSGACG00000018145 I 0.000
ENSGACG00000019218 Gasterosteus aculeatus ENSGACG00000019218 I 0.000
ENSGALG00000011059 Gallus gallus ENSGALG00000011059 I 0.000
ENSGALG00000023406 Gallus gallus ENSGALG00000023406 I 0.000
ENSGALG00000025723 Gallus gallus ENSGALG00000025723 I 0.000
ENSGALG00000026249 Gallus gallus ENSGALG00000026249 I 0.000
ENSGALG00000026434 Gallus gallus ENSGALG00000026434 I 0.000
ENSGALG00000028128 Gallus gallus ENSGALG00000028128 I 0.000
ENSGALG00000028726 Gallus gallus ENSGALG00000028726 I 0.000
ENSGALG00000028908 Gallus gallus ENSGALG00000028908 I 0.000
HOXC6 Gorilla gorilla ENSGGOG00000001628 I 0.000
HOXA6 Gorilla gorilla ENSGGOG00000002218 I 0.000
HOXB6 Gorilla gorilla ENSGGOG00000002634 I 0.000
HOXC8 Gorilla gorilla ENSGGOG00000006289 I 0.000
HOXB8 Gorilla gorilla ENSGGOG00000007941 I 0.000
BARHL1 Gorilla gorilla ENSGGOG00000008307 I 0.000
BARHL2 Gorilla gorilla ENSGGOG00000008873 I 0.000
HOXD8 Gorilla gorilla ENSGGOG00000009898 I 0.000
ENSGMOG00000000768 Gadus morhua ENSGMOG00000000768 I 0.000
ENSGMOG00000009870 Gadus morhua ENSGMOG00000009870 I 0.000
ENSGMOG00000010722 Gadus morhua ENSGMOG00000010722 I 0.000
ENSGMOG00000017889 Gadus morhua ENSGMOG00000017889 I 0.000
ENSGMOG00000017893 Gadus morhua ENSGMOG00000017893 I 0.000
ENSGMOG00000018326 Gadus morhua ENSGMOG00000018326 I 0.000
ENSGMOG00000018339 Gadus morhua ENSGMOG00000018339 I 0.000
ENSGMOG00000019983 Gadus morhua ENSGMOG00000019983 I 0.000
ENSLACG00000004504 Latimeria chalumnae ENSLACG00000004504 I 0.000
ENSLACG00000006792 Latimeria chalumnae ENSLACG00000006792 I 0.000
ENSLACG00000009061 Latimeria chalumnae ENSLACG00000009061 I 0.000
ENSLACG00000013991 Latimeria chalumnae ENSLACG00000013991 I 0.000
ENSLACG00000015099 Latimeria chalumnae ENSLACG00000015099 I 0.000
ENSLACG00000015234 Latimeria chalumnae ENSLACG00000015234 I 0.000
ENSLACG00000016619 Latimeria chalumnae ENSLACG00000016619 I 0.000
ENSLACG00000016658 Latimeria chalumnae ENSLACG00000016658 I 0.000
ENSLACG00000017339 Latimeria chalumnae ENSLACG00000017339 I 0.000
HOXC6 Loxodonta africana ENSLAFG00000001117 I 0.000
HOXD8 Loxodonta africana ENSLAFG00000004364 I 0.000
BARHL2 Loxodonta africana ENSLAFG00000004480 I 0.000
HOXA6 Loxodonta africana ENSLAFG00000006281 I 0.000
HOXB6 Loxodonta africana ENSLAFG00000013593 I 0.000
BARHL1 Loxodonta africana ENSLAFG00000015377 I 0.000
HOXC8 Loxodonta africana ENSLAFG00000018140 I 0.000
ENSLAFG00000025171 Loxodonta africana ENSLAFG00000025171 I 0.000
HOXB8 Loxodonta africana ENSLAFG00000030682 I 0.000
ENSLOCG00000004982 Lepisosteus oculatus ENSLOCG00000004982 I 0.000
ENSLOCG00000005607 Lepisosteus oculatus ENSLOCG00000005607 I 0.000
ENSLOCG00000007085 Lepisosteus oculatus ENSLOCG00000007085 I 0.000
ENSLOCG00000008089 Lepisosteus oculatus ENSLOCG00000008089 I 0.000
ENSLOCG00000010999 Lepisosteus oculatus ENSLOCG00000010999 I 0.000
ENSLOCG00000013443 Lepisosteus oculatus ENSLOCG00000013443 I 0.000
ENSLOCG00000013451 Lepisosteus oculatus ENSLOCG00000013451 I 0.000
ENSMEUG00000000878 Macropus eugenii ENSMEUG00000000878 I 0.000
ENSMEUG00000003418 Macropus eugenii ENSMEUG00000003418 I 0.000
ENSMEUG00000006929 Macropus eugenii ENSMEUG00000006929 I 0.000
ENSMEUG00000008587 Macropus eugenii ENSMEUG00000008587 I 0.000
ENSMEUG00000008748 Macropus eugenii ENSMEUG00000008748 I 0.000
ENSMEUG00000014893 Macropus eugenii ENSMEUG00000014893 I 0.000
ENSMEUG00000015407 Macropus eugenii ENSMEUG00000015407 I 0.000
ENSMICG00000000493 Microcebus murinus ENSMICG00000000493 I 0.000
HOXD8 Microcebus murinus ENSMICG00000004277 I 0.000
ENSMICG00000007528 Microcebus murinus ENSMICG00000007528 I 0.000
ENSMICG00000011718 Microcebus murinus ENSMICG00000011718 I 0.000
ENSMICG00000011722 Microcebus murinus ENSMICG00000011722 I 0.000
ENSMICG00000011747 Microcebus murinus ENSMICG00000011747 I 0.000
HOXC6 Myotis lucifugus ENSMLUG00000000485 I 0.000
HOXC8 Myotis lucifugus ENSMLUG00000003097 I 0.000
HOXB6 Myotis lucifugus ENSMLUG00000010649 I 0.000
HOXA6 Myotis lucifugus ENSMLUG00000014517 I 0.000
BARHL2 Myotis lucifugus ENSMLUG00000015680 I 0.000
ENSMLUG00000028864 Myotis lucifugus ENSMLUG00000028864 I 0.000
ENSMMUG00000000928 Macaca mulatta ENSMMUG00000000928 I 0.000
ENSMMUG00000004589 Macaca mulatta ENSMMUG00000004589 I 0.000
ENSMMUG00000006536 Macaca mulatta ENSMMUG00000006536 I 0.000
ENSMMUG00000013457 Macaca mulatta ENSMMUG00000013457 I 0.000
BARHL2 Macaca mulatta ENSMMUG00000013939 I 0.000
ENSMMUG00000020866 Macaca mulatta ENSMMUG00000020866 I 0.000
HOXB8 Macaca mulatta ENSMMUG00000020868 I 0.000
HOXD8 Macaca mulatta ENSMMUG00000023504 I 0.000
ENSMODG00000000472 Monodelphis domestica ENSMODG00000000472 I 0.000
HOXB6 Monodelphis domestica ENSMODG00000012334 I 0.000
BARHL1 Monodelphis domestica ENSMODG00000012544 I 0.000
NKX1-2 Monodelphis domestica ENSMODG00000016583 I 0.000
HOXC6 Monodelphis domestica ENSMODG00000021342 I 0.000
ENSMPUG00000002742 Mustela putorius furo ENSMPUG00000002742 I 0.000
ENSMPUG00000004626 Mustela putorius furo ENSMPUG00000004626 I 0.000
ENSMPUG00000004779 Mustela putorius furo ENSMPUG00000004779 I 0.000
ENSMPUG00000005848 Mustela putorius furo ENSMPUG00000005848 I 0.000
ENSMPUG00000005854 Mustela putorius furo ENSMPUG00000005854 I 0.000
ENSMPUG00000012529 Mustela putorius furo ENSMPUG00000012529 I 0.000
ENSMPUG00000014060 Mustela putorius furo ENSMPUG00000014060 I 0.000
ENSMPUG00000015322 Mustela putorius furo ENSMPUG00000015322 I 0.000
ENSMPUG00000015329 Mustela putorius furo ENSMPUG00000015329 I 0.000
Hoxb6 Mus musculus ENSMUSG00000000690 D 0.000
Hoxc8 Mus musculus ENSMUSG00000001657 D 0.000
Hoxc6 Mus musculus ENSMUSG00000001661 D 0.000
Barhl1 Mus musculus ENSMUSG00000026805 D 0.000
Hoxd8 Mus musculus ENSMUSG00000027102 D 0.000
Nkx1-1 Mus musculus ENSMUSG00000029112 D 0.000
Barhl2 Mus musculus ENSMUSG00000034384 D 0.000
Hoxa6 Mus musculus ENSMUSG00000043219 D 0.000
Nkx1-2 Mus musculus ENSMUSG00000048528 D 0.000
Hoxb8 Mus musculus ENSMUSG00000056648 D 0.000
ENSNLEG00000002585 Nomascus leucogenys ENSNLEG00000002585 I 0.000
ENSNLEG00000006003 Nomascus leucogenys ENSNLEG00000006003 I 0.000
ENSNLEG00000010276 Nomascus leucogenys ENSNLEG00000010276 I 0.000
ENSNLEG00000012866 Nomascus leucogenys ENSNLEG00000012866 I 0.000
ENSNLEG00000014990 Nomascus leucogenys ENSNLEG00000014990 I 0.000
ENSNLEG00000017677 Nomascus leucogenys ENSNLEG00000017677 I 0.000
ENSOANG00000002051 Ornithorhynchus anatinus ENSOANG00000002051 I 0.000
HOXC6 Ornithorhynchus anatinus ENSOANG00000004428 I 0.000
HOXB6 Ornithorhynchus anatinus ENSOANG00000009168 I 0.000
BARHL2 Ornithorhynchus anatinus ENSOANG00000009226 I 0.000
HOXC8 Ornithorhynchus anatinus ENSOANG00000014218 I 0.000
ENSOANG00000022171 Ornithorhynchus anatinus ENSOANG00000022171 I 0.000
HOXD8 Ornithorhynchus anatinus ENSOANG00000030212 I 0.000
ENSOARG00000005990 Ovis aries ENSOARG00000005990 I 0.000
ENSOARG00000006882 Ovis aries ENSOARG00000006882 I 0.000
ENSOARG00000007002 Ovis aries ENSOARG00000007002 I 0.000
ENSOARG00000009758 Ovis aries ENSOARG00000009758 I 0.000
ENSOARG00000015662 Ovis aries ENSOARG00000015662 I 0.000
ENSOARG00000016296 Ovis aries ENSOARG00000016296 I 0.000
ENSOARG00000016306 Ovis aries ENSOARG00000016306 I 0.000
ENSOARG00000016576 Ovis aries ENSOARG00000016576 I 0.000
ENSOARG00000017491 Ovis aries ENSOARG00000017491 I 0.000
BARHL2 Oryctolagus cuniculus ENSOCUG00000004213 I 0.000
HOXC8 Oryctolagus cuniculus ENSOCUG00000004741 I 0.000
HOXC6 Oryctolagus cuniculus ENSOCUG00000004743 I 0.000
HOXB6 Oryctolagus cuniculus ENSOCUG00000011560 I 0.000
BARHL1 Oryctolagus cuniculus ENSOCUG00000022030 I 0.000
HOXA6 Oryctolagus cuniculus ENSOCUG00000029344 I 0.000
HOXC8 Otolemur garnettii ENSOGAG00000003619 I 0.000
HOXC6 Otolemur garnettii ENSOGAG00000003621 I 0.000
BARHL1 Otolemur garnettii ENSOGAG00000004071 I 0.000
HOXB6 Otolemur garnettii ENSOGAG00000008661 I 0.000
BARHL2 Otolemur garnettii ENSOGAG00000011079 I 0.000
HOXA6 Otolemur garnettii ENSOGAG00000012384 I 0.000
HOXD8 Otolemur garnettii ENSOGAG00000015707 I 0.000
HOXB8 Otolemur garnettii ENSOGAG00000029480 I 0.000
NKX1-1 Otolemur garnettii ENSOGAG00000034822 I 0.000
ENSONIG00000000526 Oreochromis niloticus ENSONIG00000000526 I 0.000
ENSONIG00000000720 Oreochromis niloticus ENSONIG00000000720 I 0.000
ENSONIG00000006182 Oreochromis niloticus ENSONIG00000006182 I 0.000
ENSONIG00000006184 Oreochromis niloticus ENSONIG00000006184 I 0.000
ENSONIG00000006185 Oreochromis niloticus ENSONIG00000006185 I 0.000
ENSONIG00000011516 Oreochromis niloticus ENSONIG00000011516 I 0.000
ENSONIG00000011596 Oreochromis niloticus ENSONIG00000011596 I 0.000
ENSONIG00000012239 Oreochromis niloticus ENSONIG00000012239 I 0.000
ENSONIG00000012240 Oreochromis niloticus ENSONIG00000012240 I 0.000
ENSONIG00000013020 Oreochromis niloticus ENSONIG00000013020 I 0.000
ENSONIG00000018206 Oreochromis niloticus ENSONIG00000018206 I 0.000
ENSONIG00000019259 Oreochromis niloticus ENSONIG00000019259 I 0.000
HOXD8 Ochotona princeps ENSOPRG00000004065 I 0.000
BARHL1 Ochotona princeps ENSOPRG00000004446 I 0.000
HOXC6 Ochotona princeps ENSOPRG00000006093 I 0.000
BARHL2 Ochotona princeps ENSOPRG00000009197 I 0.000
HOXA6 Ochotona princeps ENSOPRG00000010431 I 0.000
ENSORLG00000001394 Oryzias latipes ENSORLG00000001394 I 0.000
nkx1.2la Oryzias latipes ENSORLG00000005612 I 0.000
hoxc8 Oryzias latipes ENSORLG00000007935 I 0.000
hoxb6a Oryzias latipes ENSORLG00000012387 I 0.000
ENSORLG00000017036 Oryzias latipes ENSORLG00000017036 I 0.000
ENSP00000040584 Macaca fascicularis ENSP00000040584 I 0.000
ENSP00000040584-D1 Bos grunniens ENSP00000040584-D1 I 0.000
ENSP00000222728 Macaca fascicularis ENSP00000222728 I 0.000
ENSP00000222728-D1 Bos grunniens ENSP00000222728-D1 I 0.000
ENSP00000222728-D2 Bos grunniens ENSP00000222728-D2 I 0.000
ENSP00000225648 Macaca fascicularis ENSP00000225648 I 0.000
ENSP00000239144-D1 Bos grunniens ENSP00000239144-D1 I 0.000
ENSP00000243108 Macaca fascicularis ENSP00000243108 I 0.000
ENSP00000243108-D1 Bos grunniens ENSP00000243108-D1 I 0.000
ENSP00000263610 Macaca fascicularis ENSP00000263610 I 0.000
ENSP00000315949 Macaca fascicularis ENSP00000315949 I 0.000
ENSP00000315949-D1 Bos grunniens ENSP00000315949-D1 I 0.000
ENSP00000359474 Macaca fascicularis ENSP00000359474 I 0.000
ENSPANG00000003389 Papio anubis ENSPANG00000003389 I 0.000
ENSPANG00000006243 Papio anubis ENSPANG00000006243 I 0.000
ENSPANG00000006703 Papio anubis ENSPANG00000006703 I 0.000
ENSPANG00000013799 Papio anubis ENSPANG00000013799 I 0.000
ENSPANG00000018054 Papio anubis ENSPANG00000018054 I 0.000
ENSPANG00000020330 Papio anubis ENSPANG00000020330 I 0.000
ENSPANG00000022891 Papio anubis ENSPANG00000022891 I 0.000
ENSPANG00000022895 Papio anubis ENSPANG00000022895 I 0.000
ENSPANG00000025988 Papio anubis ENSPANG00000025988 I 0.000
BARHL1 Procavia capensis ENSPCAG00000004230 I 0.000
HOXB6 Procavia capensis ENSPCAG00000006197 I 0.000
HOXC6 Procavia capensis ENSPCAG00000010993 I 0.000
BARHL2 Procavia capensis ENSPCAG00000011285 I 0.000
HOXA6 Procavia capensis ENSPCAG00000015603 I 0.000
ENSPCAG00000015753 Procavia capensis ENSPCAG00000015753 I 0.000
ENSPFOG00000001956 Poecilia formosa ENSPFOG00000001956 I 0.000
ENSPFOG00000002016 Poecilia formosa ENSPFOG00000002016 I 0.000
ENSPFOG00000003853 Poecilia formosa ENSPFOG00000003853 I 0.000
ENSPFOG00000003876 Poecilia formosa ENSPFOG00000003876 I 0.000
ENSPFOG00000010222 Poecilia formosa ENSPFOG00000010222 I 0.000
ENSPFOG00000016909 Poecilia formosa ENSPFOG00000016909 I 0.000
ENSPFOG00000017884 Poecilia formosa ENSPFOG00000017884 I 0.000
ENSPFOG00000018177 Poecilia formosa ENSPFOG00000018177 I 0.000
ENSPFOG00000022945 Poecilia formosa ENSPFOG00000022945 I 0.000
ENSPFOG00000024107 Poecilia formosa ENSPFOG00000024107 I 0.000
ENSPMAG00000004598 Petromyzon marinus ENSPMAG00000004598 I 0.000
ENSPMAG00000005735 Petromyzon marinus ENSPMAG00000005735 I 0.000
ENSPMAG00000009993 Petromyzon marinus ENSPMAG00000009993 I 0.000
ENSPPYG00000001165 Pongo abelii ENSPPYG00000001165 I 0.000
ENSPPYG00000002739 Pongo abelii ENSPPYG00000002739 I 0.000
ENSPPYG00000004593 Pongo abelii ENSPPYG00000004593 I 0.000
ENSPPYG00000004594 Pongo abelii ENSPPYG00000004594 I 0.000
ENSPPYG00000008899 Pongo abelii ENSPPYG00000008899 I 0.000
ENSPPYG00000012961 Pongo abelii ENSPPYG00000012961 I 0.000
ENSPPYG00000017702 Pongo abelii ENSPPYG00000017702 I 0.000
ENSPPYG00000019712 Pongo abelii ENSPPYG00000019712 I 0.000
ENSPSIG00000002452 Pelodiscus sinensis ENSPSIG00000002452 I 0.000
ENSPSIG00000004802 Pelodiscus sinensis ENSPSIG00000004802 I 0.000
ENSPSIG00000004815 Pelodiscus sinensis ENSPSIG00000004815 I 0.000
ENSPSIG00000006613 Pelodiscus sinensis ENSPSIG00000006613 I 0.000
ENSPSIG00000007118 Pelodiscus sinensis ENSPSIG00000007118 I 0.000
ENSPSIG00000007278 Pelodiscus sinensis ENSPSIG00000007278 I 0.000
BARHL2 Pan troglodytes ENSPTRG00000000946 I 0.000
HOXC8 Pan troglodytes ENSPTRG00000005030 I 0.000
HOXB6 Pan troglodytes ENSPTRG00000009356 I 0.000
HOXD8 Pan troglodytes ENSPTRG00000012669 I 0.000
BARHL1 Pan troglodytes ENSPTRG00000021499 I 0.000
HOXC6 Pan troglodytes ENSPTRG00000022997 I 0.000
HOXA6 Pan troglodytes ENSPTRG00000039535 I 0.000
BARHL1 Pteropus vampyrus ENSPVAG00000002046 I 0.000
HOXA6 Pteropus vampyrus ENSPVAG00000002491 I 0.000
HOXC6 Pteropus vampyrus ENSPVAG00000014724 I 0.000
ENSPVAG00000014725 Pteropus vampyrus ENSPVAG00000014725 I 0.000
HOXB6 Pteropus vampyrus ENSPVAG00000015525 I 0.000
HOXB8 Pteropus vampyrus ENSPVAG00000015529 I 0.000
HOXD8 Pteropus vampyrus ENSPVAG00000017420 I 0.000
Barhl2 Rattus norvegicus ENSRNOG00000002117 I 0.000
Nkx1-1 Rattus norvegicus ENSRNOG00000005113 I 0.000
Hoxb8 Rattus norvegicus ENSRNOG00000007585 I 0.000
Hoxb6 Rattus norvegicus ENSRNOG00000007823 I 0.000
Barhl1 Rattus norvegicus ENSRNOG00000013209 I 0.000
Hoxc6 Rattus norvegicus ENSRNOG00000016442 I 0.000
Nkx1-2 Rattus norvegicus ENSRNOG00000017006 I 0.000
Hoxc8 Rattus norvegicus ENSRNOG00000028619 I 0.000
Hoxd8 Rattus norvegicus ENSRNOG00000042480 I 0.000
LOC100909604 Rattus norvegicus ENSRNOG00000048917 I 0.000
Hoxa6 Rattus norvegicus ENSRNOG00000060066 I 0.000
HOXB6 Sorex araneus ENSSARG00000007962 I 0.000
ENSSHAG00000006951 Sarcophilus harrisii ENSSHAG00000006951 I 0.000
ENSSHAG00000007196 Sarcophilus harrisii ENSSHAG00000007196 I 0.000
ENSSHAG00000012547 Sarcophilus harrisii ENSSHAG00000012547 I 0.000
ENSSHAG00000012646 Sarcophilus harrisii ENSSHAG00000012646 I 0.000
ENSSHAG00000016034 Sarcophilus harrisii ENSSHAG00000016034 I 0.000
ENSSHAG00000016371 Sarcophilus harrisii ENSSHAG00000016371 I 0.000
ENSSHAG00000016714 Sarcophilus harrisii ENSSHAG00000016714 I 0.000
ENSSHAG00000018801 Sarcophilus harrisii ENSSHAG00000018801 I 0.000
BARHL1 Sus scrofa ENSSSCG00000005730 I 0.000
BARHL2 Sus scrofa ENSSSCG00000006914 I 0.000
NKX1-2 Sus scrofa ENSSSCG00000010733 I 0.000
ENSSSCG00000015983 Sus scrofa ENSSSCG00000015983 I 0.000
ENSSSCG00000016702 Sus scrofa ENSSSCG00000016702 I 0.000
HOXB8 Sus scrofa ENSSSCG00000017537 I 0.000
HOXB6 Sus scrofa ENSSSCG00000017539 I 0.000
HOXC6 Sus scrofa ENSSSCG00000030585 I 0.000
ENSSTOG00000012551 Ictidomys tridecemlineatus ENSSTOG00000012551 I 0.000
ENSSTOG00000016337 Ictidomys tridecemlineatus ENSSTOG00000016337 I 0.000
ENSSTOG00000020303 Ictidomys tridecemlineatus ENSSTOG00000020303 I 0.000
ENSSTOG00000021286 Ictidomys tridecemlineatus ENSSTOG00000021286 I 0.000
ENSSTOG00000022675 Ictidomys tridecemlineatus ENSSTOG00000022675 I 0.000
ENSSTOG00000023453 Ictidomys tridecemlineatus ENSSTOG00000023453 I 0.000
ENSSTOG00000024230 Ictidomys tridecemlineatus ENSSTOG00000024230 I 0.000
ENSSTOG00000025888 Ictidomys tridecemlineatus ENSSTOG00000025888 I 0.000
ENSSTOG00000028337 Ictidomys tridecemlineatus ENSSTOG00000028337 I 0.000
ENSTBEG00000010861 Tupaia belangeri ENSTBEG00000010861 I 0.000
HOXD8 Tupaia belangeri ENSTBEG00000011462 I 0.000
ENSTGUG00000002913 Taeniopygia guttata ENSTGUG00000002913 I 0.000
ENSTGUG00000003435 Taeniopygia guttata ENSTGUG00000003435 I 0.000
HOXB8 Taeniopygia guttata ENSTGUG00000003441 I 0.000
BARHL2 Taeniopygia guttata ENSTGUG00000006200 I 0.000
HOXC6 Taeniopygia guttata ENSTGUG00000015566 I 0.000
HOXC8 Taeniopygia guttata ENSTGUG00000015572 I 0.000
ENSTGUG00000015578 Taeniopygia guttata ENSTGUG00000015578 I 0.000
ENSTNIG00000001758 Tetraodon nigroviridis ENSTNIG00000001758 I 0.000
hoxc6a Tetraodon nigroviridis ENSTNIG00000001761 I 0.000
hoxc8a Tetraodon nigroviridis ENSTNIG00000001762 I 0.000
hoxb6a Tetraodon nigroviridis ENSTNIG00000001771 I 0.000
ENSTNIG00000005016 Tetraodon nigroviridis ENSTNIG00000005016 I 0.000
ENSTNIG00000006040 Tetraodon nigroviridis ENSTNIG00000006040 D 0.000
nkx1.2lb Tetraodon nigroviridis ENSTNIG00000006345 I 0.000
nkx1.2la Tetraodon nigroviridis ENSTNIG00000013347 I 0.000
pnx Tetraodon nigroviridis ENSTNIG00000013591 I 0.000
barhl2 Tetraodon nigroviridis ENSTNIG00000013759 I 0.000
ENSTRUG00000001069 Takifugu rubripes ENSTRUG00000001069 I 0.000
nkx1.2la Takifugu rubripes ENSTRUG00000001257 I 0.000
ENSTRUG00000003727 Takifugu rubripes ENSTRUG00000003727 I 0.000
barhl1a Takifugu rubripes ENSTRUG00000005590 I 0.000
nkx1.2lb Takifugu rubripes ENSTRUG00000009389 I 0.000
ENSTRUG00000009487 Takifugu rubripes ENSTRUG00000009487 I 0.000
barhl2 Takifugu rubripes ENSTRUG00000012862 I 0.000
ENSTRUG00000013775 Takifugu rubripes ENSTRUG00000013775 I 0.000
pnx Takifugu rubripes ENSTRUG00000018621 I 0.000
ENSTSYG00000001418 Tarsius syrichta ENSTSYG00000001418 I 0.000
HOXC6 Tursiops truncatus ENSTTRG00000004534 I 0.000
HOXC8 Tursiops truncatus ENSTTRG00000004538 I 0.000
HOXA6 Tursiops truncatus ENSTTRG00000006778 I 0.000
HOXB8 Tursiops truncatus ENSTTRG00000012260 I 0.000
BARHL2 Tursiops truncatus ENSTTRG00000012409 I 0.000
HOXD8 Tursiops truncatus ENSTTRG00000013777 I 0.000
ENSXMAG00000001662 Xiphophorus maculatus ENSXMAG00000001662 I 0.000
ENSXMAG00000001892 Xiphophorus maculatus ENSXMAG00000001892 I 0.000
ENSXMAG00000002840 Xiphophorus maculatus ENSXMAG00000002840 I 0.000
ENSXMAG00000002841 Xiphophorus maculatus ENSXMAG00000002841 I 0.000
ENSXMAG00000016564 Xiphophorus maculatus ENSXMAG00000016564 I 0.000
ENSXMAG00000017541 Xiphophorus maculatus ENSXMAG00000017541 I 0.000
ENSXMAG00000019481 Xiphophorus maculatus ENSXMAG00000019481 I 0.000
estExt_fgenesh2_pg.C_1850055 Branchiostoma floridae estExt_fgenesh2_pg.C_1850055 I 0.000
EVEC_0000138401 Enterobius vermicularis EVEC_0000138401 I 0.000
EVEC_0000670601 Enterobius vermicularis EVEC_0000670601 I 0.000
e_gw.260.32.1 Branchiostoma floridae e_gw.260.32.1 I 0.000
e_gw.402.19.1 Branchiostoma floridae e_gw.402.19.1 I 0.000
e_gw.402.27.1 Branchiostoma floridae e_gw.402.27.1 I 0.000
abd-A Drosophila melanogaster FBgn0000014 D 0.000
slou Drosophila melanogaster FBgn0002941 D 0.000
Ubx Drosophila melanogaster FBgn0003944 D 0.000
B-H2 Drosophila melanogaster FBgn0004854 D 0.000
B-H1 Drosophila melanogaster FBgn0011758 D 0.000
Ubx Drosophila virilis FBgn0013100 I 0.000
Ubx Drosophila simulans FBgn0014820 I 0.000
abd-A Drosophila virilis FBgn0016478 I 0.000
CG11085 Drosophila melanogaster FBgn0030408 D 0.000
CG34031 Drosophila melanogaster FBgn0054031 D 0.000
GA19667 Drosophila pseudoobscura FBgn0079663 I 0.000
GF16414 Drosophila ananassae FBgn0093435 I 0.000
GF17922 Drosophila ananassae FBgn0094940 I 0.000
GF17924 Drosophila ananassae FBgn0094942 I 0.000
GF21379 Drosophila ananassae FBgn0098381 I 0.000
GG14462 Drosophila erecta FBgn0106721 I 0.000
GG16810 Drosophila erecta FBgn0109040 I 0.000
Ubx Drosophila erecta FBgn0109042 I 0.000
GG17730 Drosophila erecta FBgn0109952 I 0.000
GG19114 Drosophila erecta FBgn0111320 I 0.000
GG19116 Drosophila erecta FBgn0111322 I 0.000
GH13609 Drosophila grimshawi FBgn0121085 I 0.000
GH18074 Drosophila grimshawi FBgn0125542 I 0.000
GH19471 Drosophila grimshawi FBgn0126936 I 0.000
GH24130 Drosophila grimshawi FBgn0131586 I 0.000
GH24903 Drosophila grimshawi FBgn0132358 I 0.000
GI15962 Drosophila mojavensis FBgn0138711 I 0.000
GI15964 Drosophila mojavensis FBgn0138713 I 0.000
GI16386 Drosophila mojavensis FBgn0139134 I 0.000
GI23753 Drosophila mojavensis FBgn0146478 I 0.000
GI24708 Drosophila mojavensis FBgn0147430 I 0.000
GI24800 Drosophila mojavensis FBgn0147522 I 0.000
GL13135 Drosophila persimilis FBgn0150741 I 0.000
GL19887 Drosophila persimilis FBgn0157485 I 0.000
GL19888 Drosophila persimilis FBgn0157486 I 0.000
GL23002 Drosophila persimilis FBgn0160592 I 0.000
GL23004 Drosophila persimilis FBgn0160594 I 0.000
GM11004 Drosophila sechellia FBgn0165949 I 0.000
GM11573 Drosophila sechellia FBgn0166516 I 0.000
GM13506 Drosophila sechellia FBgn0168437 I 0.000
GM13509 Drosophila sechellia FBgn0168440 I 0.000
GM15405 Drosophila sechellia FBgn0170323 I 0.000
GM15411 Drosophila sechellia FBgn0170329 I 0.000
GD15666 Drosophila simulans FBgn0187328 I 0.000
GD15668 Drosophila simulans FBgn0187330 I 0.000
GD19974 Drosophila simulans FBgn0191457 I 0.000
GD20268 Drosophila simulans FBgn0191744 I 0.000
GJ16761 Drosophila virilis FBgn0203942 I 0.000
GJ18853 Drosophila virilis FBgn0205999 I 0.000
GJ18855 Drosophila virilis FBgn0206001 I 0.000
GJ24446 Drosophila virilis FBgn0211526 I 0.000
GK13853 Drosophila willistoni FBgn0215861 I 0.000
GK13855 Drosophila willistoni FBgn0215863 I 0.000
GK14259 Drosophila willistoni FBgn0216265 I 0.000
GK19952 Drosophila willistoni FBgn0221949 I 0.000
GK19953 Drosophila willistoni FBgn0221950 I 0.000
GK25513 Drosophila willistoni FBgn0227472 I 0.000
GE17019 Drosophila yakuba FBgn0234505 I 0.000
GE17661 Drosophila yakuba FBgn0235111 I 0.000
GE17664 Drosophila yakuba FBgn0235114 I 0.000
GE24972 Drosophila yakuba FBgn0242066 I 0.000
GE26127 Drosophila yakuba FBgn0243166 I 0.000
Ubx Drosophila pseudoobscura FBgn0243536 I 0.000
GA22961 Drosophila pseudoobscura FBgn0244363 I 0.000
GA26453 Drosophila pseudoobscura FBgn0247827 I 0.000
GA28280 Drosophila pseudoobscura FBgn0249643 I 0.000
GA28287 Drosophila pseudoobscura FBgn0249650 I 0.000
Ubx Drosophila yakuba FBgn0260732 I 0.000
fgenesh2_pg.scaffold_134000014 Branchiostoma floridae fgenesh2_pg.scaffold_134000014 I 0.000
fgenesh2_pg.scaffold_185000054 Branchiostoma floridae fgenesh2_pg.scaffold_185000054 I 0.000
fgenesh2_pg.scaffold_260000039 Branchiostoma floridae fgenesh2_pg.scaffold_260000039 I 0.000
fgenesh2_pg.scaffold_432000036 Branchiostoma floridae fgenesh2_pg.scaffold_432000036 I 0.000
GB46956 Apis mellifera GB46956 I 0.000
GB49984 Apis mellifera GB49984 I 0.000
GB50532 Apis mellifera GB50532 I 0.000
GB51287 Apis mellifera GB51287 I 0.000
GB51290 Apis mellifera GB51290 I 0.000
GB51909 Apis mellifera GB51909 I 0.000
Gfo_R001849 Geospiza fortis Gfo_R001849 I 0.000
Gfo_R015841 Geospiza fortis Gfo_R015841 I 0.000
GPLIN_000177500 Globodera pallida GPLIN_000177500 I 0.000
GPLIN_000858900 Globodera pallida GPLIN_000858900 I 0.000
gw.62.122.1 Branchiostoma floridae gw.62.122.1 I 0.000
Hba_14265 Heterorhabditis bacteriophora Hba_14265 I 0.000
HCOI00175700 Haemonchus contortus HCOI00175700 I 0.000
HCOI01759300 Haemonchus contortus HCOI01759300 I 0.000
HCOI01954600 Haemonchus contortus HCOI01954600 I 0.000
HDID_0000273701 Hymenolepis diminuta HDID_0000273701 I 0.000
HDID_0000589101 Hymenolepis diminuta HDID_0000589101 I 0.000
HDID_0000901601 Hymenolepis diminuta HDID_0000901601 I 0.000
HDID_0000968501 Hymenolepis diminuta HDID_0000968501 I 0.000
HelroG116524 Helobdella robusta HelroG116524 I 0.000
HelroG127374 Helobdella robusta HelroG127374 I 0.000
HelroG127834 Helobdella robusta HelroG127834 I 0.000
HelroG152036 Helobdella robusta HelroG152036 I 0.000
HelroG152427 Helobdella robusta HelroG152427 I 0.000
HelroG153710 Helobdella robusta HelroG153710 I 0.000
HelroG183449 Helobdella robusta HelroG183449 I 0.000
HelroG69095 Helobdella robusta HelroG69095 I 0.000
HelroG76830 Helobdella robusta HelroG76830 I 0.000
HelroG78362 Helobdella robusta HelroG78362 I 0.000
HelroG88235 Helobdella robusta HelroG88235 I 0.000
HHAL009866-PA Halyomorpha halys HHAL009866-PA I 0.000
HHAL011305-PA Halyomorpha halys HHAL011305-PA I 0.000
HMEL013187 Heliconius melpomene HMEL013187 I 0.000
HMEL015396 Heliconius melpomene HMEL015396 I 0.000
HMEL025033 Heliconius melpomene HMEL025033 I 0.000
HMEL025034 Heliconius melpomene HMEL025034 I 0.000
HmN_000187700 Hymenolepis microstoma HmN_000187700 I 0.000
HmN_000400300 Hymenolepis microstoma HmN_000400300 I 0.000
HmN_000409500 Hymenolepis microstoma HmN_000409500 I 0.000
HmN_000448800 Hymenolepis microstoma HmN_000448800 I 0.000
HmN_000601100 Hymenolepis microstoma HmN_000601100 I 0.000
HmN_000626700 Hymenolepis microstoma HmN_000626700 I 0.000
HNAJ_0000006701 Hymenolepis nana HNAJ_0000006701 I 0.000
HNAJ_0000396301 Hymenolepis nana HNAJ_0000396301 I 0.000
HNAJ_0000785001 Hymenolepis nana HNAJ_0000785001 I 0.000
HNAJ_0000941201 Hymenolepis nana HNAJ_0000941201 I 0.000
HNAJ_0001296701 Hymenolepis nana HNAJ_0001296701 I 0.000
HPBE_0001151801 Heligmosomoides bakeri HPBE_0001151801 I 0.000
HPBE_0001624301 Heligmosomoides bakeri HPBE_0001624301 I 0.000
HPLM_0000110101 Haemonchus placei HPLM_0000110101 I 0.000
HPLM_0001400701 Haemonchus placei HPLM_0001400701 I 0.000
Hsal_01133--XP_001122544.1_APIME Harpegnathos saltator Hsal_01133--XP_001122544.1_APIME I 0.000
Hsal_01804--XP_623989.2_APIME Harpegnathos saltator Hsal_01804--XP_623989.2_APIME I 0.000
Hsal_12039--XP_396835.3_APIME Harpegnathos saltator Hsal_12039--XP_396835.3_APIME I 0.000
Hsal_12287--XP_001121415.1_APIME Harpegnathos saltator Hsal_12287--XP_001121415.1_APIME I 0.000
ISCW005223 Ixodes scapularis ISCW005223 I 0.000
ISCW018939 Ixodes scapularis ISCW018939 I 0.000
ISCW021054 Ixodes scapularis ISCW021054 I 0.000
ISCW021058 Ixodes scapularis ISCW021058 I 0.000
KGM_06193 Danaus plexippus KGM_06193 I 0.000
KGM_08296 Danaus plexippus KGM_08296 I 0.000
KGM_16361 Danaus plexippus KGM_16361 I 0.000
KGM_22302 Danaus plexippus KGM_22302 I 0.000
L596_g24598 Steinernema carpocapsae L596_g24598 I 0.000
L596_g5685 Steinernema carpocapsae L596_g5685 I 0.000
L596_g6462 Steinernema carpocapsae L596_g6462 I 0.000
L596_g7858 Steinernema carpocapsae L596_g7858 I 0.000
L798_00314 Zootermopsis nevadensis L798_00314 I 0.000
L798_02442 Zootermopsis nevadensis L798_02442 I 0.000
L798_08919 Zootermopsis nevadensis L798_08919 I 0.000
L798_09256 Zootermopsis nevadensis L798_09256 I 0.000
L889_g11118 Steinernema feltiae L889_g11118 I 0.000
L889_g15184 Steinernema feltiae L889_g15184 I 0.000
L889_g2174 Steinernema feltiae L889_g2174 I 0.000
L889_g24813 Steinernema feltiae L889_g24813 I 0.000
L889_g935 Steinernema feltiae L889_g935 I 0.000
L892_g11520 Steinernema scapterisci L892_g11520 I 0.000
L892_g21846 Steinernema scapterisci L892_g21846 I 0.000
L892_g26614 Steinernema scapterisci L892_g26614 I 0.000
L892_g3515 Steinernema scapterisci L892_g3515 I 0.000
L893_g11740 Steinernema glaseri L893_g11740 I 0.000
L893_g16008 Steinernema glaseri L893_g16008 I 0.000
L893_g21192 Steinernema glaseri L893_g21192 I 0.000
L898_g28864 Steinernema monticolum L898_g28864 I 0.000
L898_g32563 Steinernema monticolum L898_g32563 I 0.000
L898_g34601 Steinernema monticolum L898_g34601 I 0.000
L898_g9422 Steinernema monticolum L898_g9422 I 0.000
LCUP000261 Lucilia cuprina LCUP000261 I 0.000
LCUP000267 Lucilia cuprina LCUP000267 I 0.000
LCUP004484 Lucilia cuprina LCUP004484 I 0.000
LCUP004485 Lucilia cuprina LCUP004485 I 0.000
LCUP006696 Lucilia cuprina LCUP006696 I 0.000
LCUP015082 Lucilia cuprina LCUP015082 I 0.000
LCUP016407 Lucilia cuprina LCUP016407 I 0.000
LDEC003580 Leptinotarsa decemlineata LDEC003580 I 0.000
LDEC005305 Leptinotarsa decemlineata LDEC005305 I 0.000
LDEC011522 Leptinotarsa decemlineata LDEC011522 I 0.000
LDEC013944 Leptinotarsa decemlineata LDEC013944 I 0.000
LLOJ006856 Lutzomyia longipalpis LLOJ006856 I 0.000
LLOJ008225 Lutzomyia longipalpis LLOJ008225 I 0.000
LotgiG100213 Lottia gigantea LotgiG100213 I 0.000
LotgiG109466 Lottia gigantea LotgiG109466 I 0.000
LotgiG115738 Lottia gigantea LotgiG115738 I 0.000
LotgiG120090 Lottia gigantea LotgiG120090 I 0.000
LotgiG156931 Lottia gigantea LotgiG156931 I 0.000
LotgiG185752 Lottia gigantea LotgiG185752 I 0.000
LotgiG99849 Lottia gigantea LotgiG99849 I 0.000
MCINX001301 Melitaea cinxia MCINX001301 I 0.000
MCINX001985 Melitaea cinxia MCINX001985 I 0.000
MCINX011862 Melitaea cinxia MCINX011862 I 0.000
MCINX012819 Melitaea cinxia MCINX012819 I 0.000
MCINX017037 Melitaea cinxia MCINX017037 I 0.000
MCOS_0000337601 Mesocestoides corti MCOS_0000337601 I 0.000
MCOS_0000596101 Mesocestoides corti MCOS_0000596101 I 0.000
MCOS_0000655801 Mesocestoides corti MCOS_0000655801 I 0.000
MCOS_0000660501 Mesocestoides corti MCOS_0000660501 I 0.000
MCOS_0000737901 Mesocestoides corti MCOS_0000737901 I 0.000
MDOA003337 Musca domestica MDOA003337 I 0.000
MDOA004959 Musca domestica MDOA004959 I 0.000
MDOA006011 Musca domestica MDOA006011 I 0.000
MDOA006110 Musca domestica MDOA006110 I 0.000
MDOA008856 Musca domestica MDOA008856 I 0.000
MDOA009747 Musca domestica MDOA009747 I 0.000
MDOA010461 Musca domestica MDOA010461 I 0.000
MDOA014719 Musca domestica MDOA014719 I 0.000
MhA1_Contig194.frz3.gene47 Meloidogyne hapla MhA1_Contig194.frz3.gene47 I 0.000
MhA1_Contig287.frz3.gene5 Meloidogyne hapla MhA1_Contig287.frz3.gene5 I 0.000
Minc01292 Meloidogyne incognita Minc01292 I 0.000
ML00268a Mnemiopsis leidyi ML00268a I 0.000
ML042114a Mnemiopsis leidyi ML042114a I 0.000
ML08269a Mnemiopsis leidyi ML08269a I 0.000
ML16524a Mnemiopsis leidyi ML16524a I 0.000
Myotis_brandtii_HOXA6_10034035 Myotis brandtii Myotis_brandtii_HOXA6_10034035 I 0.000
Myotis_brandtii_Hoxb6_10017017 Myotis brandtii Myotis_brandtii_Hoxb6_10017017 I 0.000
Myotis_brandtii_HOXB8_10017021 Myotis brandtii Myotis_brandtii_HOXB8_10017021 I 0.000
Myotis_brandtii_Hoxc6_10022968 Myotis brandtii Myotis_brandtii_Hoxc6_10022968 I 0.000
Myotis_brandtii_Hoxc8_10022969 Myotis brandtii Myotis_brandtii_Hoxc8_10022969 I 0.000
Myotis_brandtii_HOXD8_10035000 Myotis brandtii Myotis_brandtii_HOXD8_10035000 I 0.000
nAv.1.0.1.g01894 Acanthocheilonema viteae nAv.1.0.1.g01894 I 0.000
nAv.1.0.1.g10073 Acanthocheilonema viteae nAv.1.0.1.g10073 I 0.000
NBR_0000165001 Nippostrongylus brasiliensis NBR_0000165001 I 0.000
NBR_0000761801 Nippostrongylus brasiliensis NBR_0000761801 I 0.000
NBR_0001229401 Nippostrongylus brasiliensis NBR_0001229401 I 0.000
NECAME_00112 Necator americanus NECAME_00112 I 0.000
NECAME_00457 Necator americanus NECAME_00457 I 0.000
NECAME_13125 Necator americanus NECAME_13125 I 0.000
NECAME_15065 Necator americanus NECAME_15065 I 0.000
NECAME_15538 Necator americanus NECAME_15538 I 0.000
NEMVEDRAFT_v1g123192 Nematostella vectensis NEMVEDRAFT_v1g123192 I 0.000
NEMVEDRAFT_v1g129868 Nematostella vectensis NEMVEDRAFT_v1g129868 D 0.000
NEMVEDRAFT_v1g197493 Nematostella vectensis NEMVEDRAFT_v1g197493 I 0.000
NEMVEDRAFT_v1g57885 Nematostella vectensis NEMVEDRAFT_v1g57885 I 0.000
NEMVEDRAFT_v1g6429 Nematostella vectensis NEMVEDRAFT_v1g6429 I 0.000
NEMVEDRAFT_v1g98238 Nematostella vectensis NEMVEDRAFT_v1g98238 I 0.000
nLs.2.1.2.g00804 Litomosoides sigmodontis nLs.2.1.2.g00804 I 0.000
nRc.2.0.1.g02146 Romanomermis culicivorax nRc.2.0.1.g02146 I 0.000
nRc.2.0.1.g10352 Romanomermis culicivorax nRc.2.0.1.g10352 I 0.000
nRc.2.0.1.g24517 Romanomermis culicivorax nRc.2.0.1.g24517 I 0.000
NV11609 Nasonia vitripennis NV11609 I 0.000
NV12623 Nasonia vitripennis NV12623 I 0.000
NV14134 Nasonia vitripennis NV14134 I 0.000
NV15143 Nasonia vitripennis NV15143 I 0.000
NV17848 Nasonia vitripennis NV17848 I 0.000
Ocbimv22008631m.g Octopus bimaculoides Ocbimv22008631m.g I 0.000
Ocbimv22009169m.g Octopus bimaculoides Ocbimv22009169m.g I 0.000
Ocbimv22009726m.g Octopus bimaculoides Ocbimv22009726m.g I 0.000
Ocbimv22021570m.g Octopus bimaculoides Ocbimv22021570m.g I 0.000
Ocbimv22033340m.g Octopus bimaculoides Ocbimv22033340m.g I 0.000
OESDEN_00444 Oesophagostomum dentatum OESDEN_00444 I 0.000
OESDEN_01506 Oesophagostomum dentatum OESDEN_01506 I 0.000
OESDEN_01711 Oesophagostomum dentatum OESDEN_01711 I 0.000
Ogr02753 Ophisaurus gracilis Ogr02753 I 0.000
Ogr11465 Ophisaurus gracilis Ogr11465 I 0.000
Ogr11834 Ophisaurus gracilis Ogr11834 I 0.000
Ogr12574 Ophisaurus gracilis Ogr12574 I 0.000
Ogr12576 Ophisaurus gracilis Ogr12576 I 0.000
Ogr13909 Ophisaurus gracilis Ogr13909 I 0.000
Ogr15852 Ophisaurus gracilis Ogr15852 I 0.000
PEQ_0000380401 Parascaris equorum PEQ_0000380401 I 0.000
PEQ_0001319301 Parascaris equorum PEQ_0001319301 I 0.000
PHUM210980 Pediculus humanus PHUM210980 I 0.000
PHUM341810 Pediculus humanus PHUM341810 I 0.000
PHUM433380 Pediculus humanus PHUM433380 I 0.000
PHUM606500 Pediculus humanus PHUM606500 I 0.000
Ppa-ceh-19 Pristionchus pacificus PPA16223 I 0.000
Ppa-ceh-1 Pristionchus pacificus PPA23479 I 0.000
PPAI000517 Phlebotomus papatasi PPAI000517 I 0.000
PPAI000860 Phlebotomus papatasi PPAI000860 I 0.000
PPAI004617 Phlebotomus papatasi PPAI004617 I 0.000
PPAI006981 Phlebotomus papatasi PPAI006981 I 0.000
PPAI009126 Phlebotomus papatasi PPAI009126 I 0.000
PTRK_0000308400 Parastrongyloides trichosuri PTRK_0000308400 I 0.000
PTRK_0000810400 Parastrongyloides trichosuri PTRK_0000810400 I 0.000
PTRK_0001335600 Parastrongyloides trichosuri PTRK_0001335600 I 0.000
Pvit_02709 Pogona vitticeps Pvit_02709 I 0.000
Pvit_04620 Pogona vitticeps Pvit_04620 I 0.000
Pvit_07417 Pogona vitticeps Pvit_07417 I 0.000
Pvit_07418 Pogona vitticeps Pvit_07418 I 0.000
Pvit_08154 Pogona vitticeps Pvit_08154 I 0.000
Pvit_14175 Pogona vitticeps Pvit_14175 I 0.000
Pvit_18296 Pogona vitticeps Pvit_18296 I 0.000
Pvit_18298 Pogona vitticeps Pvit_18298 I 0.000
PXEA_0001196601 Protopolystoma xenopodis PXEA_0001196601 I 0.000
PXEA_0002012301 Protopolystoma xenopodis PXEA_0002012301 I 0.000
Q0N4H9_NEMVE Nematostella vectensis Q0N4H9_NEMVE D 0.000
Q2PE40_DROME Drosophila melanogaster Q2PE40_DROME I 0.000
Q8I9J5_9BILA Spadella cephaloptera Q8I9J5_9BILA D 0.000
Q9GP48_9TURB Discocelis tigrina Q9GP48_9TURB D 0.000
RPRC000565 Rhodnius prolixus RPRC000565 I 0.000
RPRC000936 Rhodnius prolixus RPRC000936 I 0.000
RPRC000954 Rhodnius prolixus RPRC000954 I 0.000
RPRC014501 Rhodnius prolixus RPRC014501 I 0.000
RSKR_0000507300 Rhabditophanes kr3021 RSKR_0000507300 I 0.000
RSKR_0000751200 Rhabditophanes kr3021 RSKR_0000751200 I 0.000
RSKR_0000927900 Rhabditophanes kr3021 RSKR_0000927900 I 0.000
Sakowv30000861m.g Saccoglossus kowalevskii Sakowv30000861m.g I 0.000
Sakowv30004224m.g Saccoglossus kowalevskii Sakowv30004224m.g I 0.000
Sakowv30007134m.g Saccoglossus kowalevskii Sakowv30007134m.g I 0.000
Sakowv30014246m.g Saccoglossus kowalevskii Sakowv30014246m.g I 0.000
Sakowv30043910m.g Saccoglossus kowalevskii Sakowv30043910m.g I 0.000
Sakowv30043912m.g Saccoglossus kowalevskii Sakowv30043912m.g I 0.000
SBAD_0000185401 Soboliphyme baturini SBAD_0000185401 I 0.000
scaffold279-EXSNAP2012.15 Pristionchus exspectatus scaffold279-EXSNAP2012.15 I 0.000
scaffold330-EXSNAP2012.16 Pristionchus exspectatus scaffold330-EXSNAP2012.16 I 0.000
SCUD_0000395601 Schistosoma curassoni SCUD_0000395601 I 0.000
SCUD_0000695501 Schistosoma curassoni SCUD_0000695501 I 0.000
SCUD_0000985401 Schistosoma curassoni SCUD_0000985401 I 0.000
SINV10177 Solenopsis invicta SINV10177 I 0.000
SINV20690 Solenopsis invicta SINV20690 I 0.000
SINV20720 Solenopsis invicta SINV20720 I 0.000
SINV22427 Solenopsis invicta SINV22427 I 0.000
SINV26130 Solenopsis invicta SINV26130 I 0.000
Sjc_0009580 Schistosoma japonicum Sjc_0009580 I 0.000
Sjc_0032510 Schistosoma japonicum Sjc_0032510 I 0.000
Sjc_0047710 Schistosoma japonicum Sjc_0047710 I 0.000
Sjc_0066280 Schistosoma japonicum Sjc_0066280 I 0.000
Sjc_0132380 Schistosoma japonicum Sjc_0132380 I 0.000
SMAR001128 Strigamia maritima SMAR001128 I 0.000
SMAR004167 Strigamia maritima SMAR004167 I 0.000
SMAR004168 Strigamia maritima SMAR004168 I 0.000
SMAR005412 Strigamia maritima SMAR005412 I 0.000
SMAR006886 Strigamia maritima SMAR006886 I 0.000
SMAR013498 Strigamia maritima SMAR013498 I 0.000
SMAR014502 Strigamia maritima SMAR014502 I 0.000
Smp_001980 Schistosoma mansoni Smp_001980 I 0.000
Smp_002640 Schistosoma mansoni Smp_002640 I 0.000
SMRZ_0000629801 Schistosoma margrebowiei SMRZ_0000629801 I 0.000
SMRZ_0001483501 Schistosoma margrebowiei SMRZ_0001483501 I 0.000
SMRZ_0001964901 Schistosoma margrebowiei SMRZ_0001964901 I 0.000
SMRZ_0002083001 Schistosoma margrebowiei SMRZ_0002083001 I 0.000
SMTD_0000863301 Schistosoma mattheei SMTD_0000863301 I 0.000
SMTD_0000970901 Schistosoma mattheei SMTD_0000970901 I 0.000
SMU15014429 Schmidtea mediterranea SMU15014429 I 0.000
SMU15016057 Schmidtea mediterranea SMU15016057 I 0.000
SMU15024651 Schmidtea mediterranea SMU15024651 I 0.000
SMU15024817 Schmidtea mediterranea SMU15024817 I 0.000
SMU15025933 Schmidtea mediterranea SMU15025933 I 0.000
SMU15030787 Schmidtea mediterranea SMU15030787 I 0.000
SMU15031041 Schmidtea mediterranea SMU15031041 I 0.000
SMU15031298 Schmidtea mediterranea SMU15031298 I 0.000
SMU15037813 Schmidtea mediterranea SMU15037813 I 0.000
SMU15038225 Schmidtea mediterranea SMU15038225 I 0.000
SMUV_0000895701 Syphacia muris SMUV_0000895701 I 0.000
SNAPOd2T00000237001 Oikopleura dioica SNAPOd2T00000237001 I 0.000
snap_masked-nMf.1.1.scaf03457-processed-gene-0.4 Meloidogyne floridensis snap_masked-nMf.1.1.scaf03457-processed-gene-0.4 I 0.000
snap_masked-nMf.1.1.scaf12486-processed-gene-0.2 Meloidogyne floridensis snap_masked-nMf.1.1.scaf12486-processed-gene-0.2 I 0.000
SPAL_0000203700 Strongyloides papillosus SPAL_0000203700 I 0.000
SPAL_0000699100 Strongyloides papillosus SPAL_0000699100 I 0.000
SPAL_0001354300 Strongyloides papillosus SPAL_0001354300 I 0.000
SPU_002964 Strongylocentrotus purpuratus SPU_002964 I 0.000
SPU_004787 Strongylocentrotus purpuratus SPU_004787 I 0.000
SPU_012491 Strongylocentrotus purpuratus SPU_012491 I 0.000
SPU_014164 Strongylocentrotus purpuratus SPU_014164 I 0.000
SPU_024093 Strongylocentrotus purpuratus SPU_024093 I 0.000
SROB_0001524601 Schistosoma rodhaini SROB_0001524601 I 0.000
SSLN_0000238601 Schistocephalus solidus SSLN_0000238601 I 0.000
SSLN_0000423301 Schistocephalus solidus SSLN_0000423301 I 0.000
SSLN_0001327301 Schistocephalus solidus SSLN_0001327301 I 0.000
SSTP_0000484300 Strongyloides stercoralis SSTP_0000484300 I 0.000
SSTP_0001096700 Strongyloides stercoralis SSTP_0001096700 I 0.000
SSTP_0001147400 Strongyloides stercoralis SSTP_0001147400 I 0.000
SVE_0747200 Strongyloides venezuelensis SVE_0747200 I 0.000
SVE_1089200 Strongyloides venezuelensis SVE_1089200 I 0.000
SVE_1096700 Strongyloides venezuelensis SVE_1096700 I 0.000
SVUK_0000977401 Strongylus vulgaris SVUK_0000977401 I 0.000
T265_00637 Opisthorchis viverrini T265_00637 I 0.000
T265_01789 Opisthorchis viverrini T265_01789 I 0.000
T265_04983 Opisthorchis viverrini T265_04983 I 0.000
T265_10107 Opisthorchis viverrini T265_10107 I 0.000
TASK_0000335101 Taenia asiatica TASK_0000335101 I 0.000
TASK_0000423801 Taenia asiatica TASK_0000423801 I 0.000
TASK_0000525001 Taenia asiatica TASK_0000525001 I 0.000
TASK_0000792901 Taenia asiatica TASK_0000792901 I 0.000
TASK_0000902401 Taenia asiatica TASK_0000902401 I 0.000
TC000424 Tribolium castaneum TC000424 I 0.000
TC000894 Tribolium castaneum TC000894 I 0.000
TC000903 Tribolium castaneum TC000903 I 0.000
TC001164 Tribolium castaneum TC001164 I 0.000
TC012332 Tribolium castaneum TC012332 I 0.000
TCLT_0000618201 Thelazia callipaeda TCLT_0000618201 I 0.000
TCNE_0000667601 Toxocara canis TCNE_0000667601 I 0.000
TCNE_0001025801 Toxocara canis TCNE_0001025801 I 0.000
TCNE_0001388201 Toxocara canis TCNE_0001388201 I 0.000
TELCIR_09407 Teladorsagia circumcincta TELCIR_09407 I 0.000
TELCIR_12944 Teladorsagia circumcincta TELCIR_12944 I 0.000
TELCIR_14127 Teladorsagia circumcincta TELCIR_14127 I 0.000
tetur02g11920 Tetranychus urticae tetur02g11920 I 0.000
tetur02g13520 Tetranychus urticae tetur02g13520 I 0.000
tetur02g13540 Tetranychus urticae tetur02g13540 I 0.000
tetur11g02100 Tetranychus urticae tetur11g02100 I 0.000
tetur20g02400 Tetranychus urticae tetur20g02400 I 0.000
tetur32g01060 Tetranychus urticae tetur32g01060 I 0.000
TMUE_s0004009300 Trichuris muris TMUE_s0004009300 I 0.000
TMUE_s0071002000 Trichuris muris TMUE_s0071002000 I 0.000
TMUE_s0071002100 Trichuris muris TMUE_s0071002100 I 0.000
TRE_0000267801 Trichobilharzia regenti TRE_0000267801 I 0.000
TRE_0000616801 Trichobilharzia regenti TRE_0000616801 I 0.000
TsM_000009400 Taenia solium TsM_000009400 I 0.000
TsM_000022700 Taenia solium TsM_000022700 I 0.000
TsM_000371000 Taenia solium TsM_000371000 I 0.000
TsM_000826000 Taenia solium TsM_000826000 I 0.000
TsM_000932300 Taenia solium TsM_000932300 I 0.000
TTAC_0000135401 Hydatigera taeniaeformis TTAC_0000135401 I 0.000
TTAC_0000215101 Hydatigera taeniaeformis TTAC_0000215101 I 0.000
TTAC_0000685001 Hydatigera taeniaeformis TTAC_0000685001 I 0.000
TTAC_0000701201 Hydatigera taeniaeformis TTAC_0000701201 I 0.000