TCM_041816 (Theobroma cacao)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 TCM_041816 T280636_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.979
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.979
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.979
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
EOY34004 Myb 597 647
EOY34005 Myb 398 448

Links

Other Myb/SANT family TFs
Other Theobroma cacao TFs

198 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
29738.m001046 Ricinus communis 29738.m001046 I 0.000
Aquca_002_01098 Aquilegia coerulea Aquca_002_01098 I 0.000
BRADI1G69617 Brachypodium distachyon BRADI1G69617 N 0.000
cassava12330.valid.m1 Manihot esculenta cassava12330.valid.m1 I 0.000
chr2.CM0749.410.nc Lotus japonicus chr2.CM0749.410.nc I 0.000
Eucgr.G02349 Eucalyptus grandis Eucgr.G02349 I 0.000
F775_14771 Aegilops tauschii F775_14771 N 0.000
GLYMA01G22510 Glycine max GLYMA01G22510 I 0.000
GLYMA02G11140 Glycine max GLYMA02G11140 I 0.000
GRMZM2G077045 Zea mays GRMZM2G077045 N 0.000
GRMZM2G342647 Zea mays GRMZM2G342647 N 0.000
GRMZM5G894234 Zea mays GRMZM5G894234 N 0.000
LPERR03G07880 Leersia perrieri LPERR03G07880 N 0.000
Lus10021708.g Linum usitatissimum Lus10021708.g I 0.000
MLOC_50895 Hordeum vulgare MLOC_50895 N 0.000
MTR_1g093670 Medicago truncatula MTR_1g093670 I 0.000
OB03G19030 Oryza brachyantha OB03G19030 N 0.000
OBART03G08740 Oryza barthii OBART03G08740 N 0.000
OGLUM03G08850 Oryza glumaepatula OGLUM03G08850 N 0.000
OLONG_014784 Oryza longistaminata OLONG_014784 N 0.000
OMERI02G18080 Oryza meridionalis OMERI02G18080 N 0.000
ONIVA06G00900 Oryza nivara ONIVA06G00900 N 0.000
OPUNC03G08410 Oryza punctata OPUNC03G08410 N 0.000
ORGLA03G0084800 Oryza glaberrima ORGLA03G0084800 N 0.000
ORUFI03G08860 Oryza rufipogon ORUFI03G08860 N 0.000
Pavir.Ib00786 Panicum virgatum Pavir.Ib00786 N 0.000
PDK_20s1306131g001 Phoenix dactylifera PDK_20s1306131g001 I 0.000
PGSC0003DMG400000809 Solanum tuberosum PGSC0003DMG400000809 I 0.000
POPTR_0010s13980 Populus trichocarpa POPTR_0010s13980 I 0.000
SapurV1A.0079s0500 Salix purpurea SapurV1A.0079s0500 I 0.000
Traes_4BL_2136196AE Triticum aestivum Traes_4BL_2136196AE N 0.000
SOG1 Vitis vinifera VIT_01s0011g02990 I 0.000