TCM_041816 (Theobroma cacao)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 TCM_041816 T280636_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.979
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.979
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.979
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
EOY34004 Myb 597 647
EOY34005 Myb 398 448

Links

Other Myb/SANT family TFs
Other Theobroma cacao TFs

198 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
PV04_00380 Capronia semiimmersa PV04_00380 N 0.000
PV08_05024 Exophiala spinifera PV08_05024 N 0.000