Eucgr.B02351 (Eucalyptus grandis)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 Eucgr.B02351 T286766_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 1.000
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.979
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.979
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Eucgr.B02351.1 Myb 557 607

Links

Other Myb/SANT family TFs
Other Eucalyptus grandis TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
bcl11aa Tetraodon nigroviridis ENSTNIG00000004033 N 0.000
ENSFALG00000002563 Ficedula albicollis ENSFALG00000002563 N 0.000
ENSMPUG00000003031 Mustela putorius furo ENSMPUG00000003031 N 0.000
ENSOCUG00000024296 Oryctolagus cuniculus ENSOCUG00000024296 I 0.000
ENSXMAG00000004749 Xiphophorus maculatus ENSXMAG00000004749 N 0.000
im:7142702 Takifugu rubripes ENSTRUG00000018074 I 0.000