Gorai.006G172000 (Gossypium raimondii)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 Gorai.006G172000 T287597_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.891 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.883 0.936
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.883 0.936
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.831 0.936
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Gorai.006G172000.1 Myb 535 585
Gorai.006G172000.2 Myb 535 585
Gorai.006G172000.3 Myb 535 565
Gorai.006G172000.4 Myb 529 579
Gorai.006G172000.5 Myb 341 391

Links

Other Myb/SANT family TFs
Other Gossypium raimondii TFs

207 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Aquca_003_00096 Aquilegia coerulea Aquca_003_00096 I 0.901
Traes_4BL_AB2636FB0 Triticum aestivum Traes_4BL_AB2636FB0 I 0.891
Traes_4DL_3849A9A5F Triticum aestivum Traes_4DL_3849A9A5F I 0.891
TCM_041816 Theobroma cacao TCM_041816 I 0.891
TCM_021921 Theobroma cacao TCM_021921 I 0.891
TRIUR3_18647 Triticum urartu TRIUR3_18647 I 0.891
Traes_4AS_FA7E65184 Triticum aestivum Traes_4AS_FA7E65184 I 0.891
VIT_06s0004g04940 Vitis vinifera VIT_06s0004g04940 I 0.891
28880.m000016 Ricinus communis 28880.m000016 I 0.891
cassava19451.valid.m1 Manihot esculenta cassava19451.valid.m1 I 0.891
Pm002686 Prunus mume Pm002686 I 0.891
Pm000720 Prunus mume Pm000720 I 0.891
Cla008361 Citrullus lanatus Cla008361 I 0.891
Si034524m.g Setaria italica Si034524m.g I 0.891
Si016548m.g Setaria italica Si016548m.g I 0.891
OPUNC03G11810 Oryza punctata OPUNC03G11810 I 0.891
ORGLA03G0118300 Oryza glaberrima ORGLA03G0118300 I 0.891
ONIVA11G13450 Oryza nivara ONIVA11G13450 I 0.891
OMERI03G11490 Oryza meridionalis OMERI03G11490 I 0.891
OGLUM03G12230 Oryza glumaepatula OGLUM03G12230 I 0.891
OLONG_025333 Oryza longistaminata OLONG_025333 I 0.891
ORUFI03G12870 Oryza rufipogon ORUFI03G12870 I 0.891
OS03G0274300 Oryza sativa OS03G0274300 I 0.891
PRUPE_ppa002522mg Prunus persica PRUPE_ppa002522mg I 0.891
Sb01g039650 Sorghum bicolor Sb01g039650 I 0.891
PRUPE_ppa002403mg Prunus persica PRUPE_ppa002403mg I 0.891
POPTR_0009s03730 Populus trichocarpa POPTR_0009s03730 I 0.891
PGSC0003DMG400030324 Solanum tuberosum PGSC0003DMG400030324 I 0.891
POPTR_0001s24840 Populus trichocarpa POPTR_0001s24840 I 0.891
cassava19452.valid.m1 Manihot esculenta cassava19452.valid.m1 I 0.891
cassava30955.valid.m1 Manihot esculenta cassava30955.valid.m1 I 0.891
orange1.1g042386m.g Citrus sinensis orange1.1g042386m.g I 0.891
Pavir.Ia03771 Panicum virgatum Pavir.Ia03771 I 0.891
MDP0000222004 Malus domestica MDP0000222004 N 0.891
MDP0000209974 Malus domestica MDP0000209974 I 0.891
MDP0000137531 Malus domestica MDP0000137531 I 0.891
MDP0000138764 Malus domestica MDP0000138764 N 0.891
Pavir.J18132 Panicum virgatum Pavir.J18132 I 0.891
SapurV1A.0040s0420 Salix purpurea SapurV1A.0040s0420 I 0.891
PDK_20s1300944g001 Phoenix dactylifera PDK_20s1300944g001 N 0.891
PDK_20s1590481g002 Phoenix dactylifera PDK_20s1590481g002 N 0.891
PK21687.1 Cannabis sativa PK21687.1 D 0.891
Thhalv10013086m.g Eutrema salsugineum Thhalv10013086m.g I 0.891
SapurV1A.0041s0150 Salix purpurea SapurV1A.0041s0150 I 0.891
MDP0000119092 Malus domestica MDP0000119092 N 0.891
Lus10024385.g Linum usitatissimum Lus10024385.g I 0.891
Aquca_009_00956 Aquilegia coerulea Aquca_009_00956 I 0.891
Bostr.26833s0301 Boechera stricta Bostr.26833s0301 I 0.891
mgf005791m Mimulus guttatus mgf005791m I 0.891
e_gw1.132.51.1 Physcomitrella patens e_gw1.132.51.1 I 0.891
OBART03G12240 Oryza barthii OBART03G12240 I 0.891
Cucsa.117790 Cucumis sativus Cucsa.117790 I 0.891
Cagra.1317s0071 Capsella grandiflora Cagra.1317s0071 I 0.891
Carubv10026172m.g Capsella rubella Carubv10026172m.g I 0.891
Gorai.003G130700 Gossypium raimondii Gorai.003G130700 I 0.891
Lus10010844.g Linum usitatissimum Lus10010844.g I 0.891
evm.TU.supercontig_81.127 Carica papaya evm.TU.supercontig_81.127 I 0.891
Eucgr.B02351 Eucalyptus grandis Eucgr.B02351 I 0.891
Ciclev10027927m.g Citrus clementina Ciclev10027927m.g I 0.891
cassava19453.valid.m1 Manihot esculenta cassava19453.valid.m1 I 0.891
Solyc06g076270.2 Solanum lycopersicum Solyc06g076270.2 I 0.891
GSMUA_Achr9G03910_001 Musa acuminata GSMUA_Achr9G03910_001 I 0.891
BGIOSGA012326 Oryza indica BGIOSGA012326 I 0.891
TRP1 Arabidopsis thaliana AT5G59430 D 0.891
F775_17181 Aegilops tauschii F775_17181 I 0.891
LPERR03G10840 Leersia perrieri LPERR03G10840 I 0.891
ATTRP1 Arabidopsis lyrata fgenesh2_kg.8__1886__AT5G59430.4 I 0.891
GSMUA_Achr10G22620_001 Musa acuminata GSMUA_Achr10G22620_001 I 0.891
GLYMA15G04200 Glycine max GLYMA15G04200 I 0.891
GLYMA13G41210 Glycine max GLYMA13G41210 I 0.891
GLYMA11G14760 Glycine max GLYMA11G14760 I 0.891
GRMZM2G063151 Zea mays GRMZM2G063151 I 0.891
GRMZM2G110309 Zea mays GRMZM2G110309 I 0.891
MLOC_59817 Hordeum vulgare MLOC_59817 I 0.891
GSMUA_Achr8G20810_001 Musa acuminata GSMUA_Achr8G20810_001 I 0.891
AMTR_s00009p00107000 Amborella trichopoda AMTR_s00009p00107000 I 0.891
OB03G22340 Oryza brachyantha OB03G22340 I 0.891
BRADI1G66677 Brachypodium distachyon BRADI1G66677 I 0.891
gene18432-v1.0-hybrid Fragaria vesca gene18432-v1.0-hybrid I 0.883
gw1.98.100.1 Physcomitrella patens gw1.98.100.1 I 0.883
MTR_7g061840 Medicago truncatula MTR_7g061840 I 0.883
GLYMA07G15940 Glycine max GLYMA07G15940 I 0.883
GLYMA18G39911 Glycine max GLYMA18G39911 I 0.883
Bo9g139390 Brassica oleracea Bo9g139390 I 0.883
gene02230-v1.0-hybrid Fragaria vesca gene02230-v1.0-hybrid I 0.883
Bra002566 Brassica rapa Bra002566 I 0.883
Solyc06g005590.2 Solanum lycopersicum Solyc06g005590.2 I 0.883
Ca_21136 Cicer arietinum Ca_21136 I 0.883
GLYMA12G06680 Glycine max GLYMA12G06680 I 0.883
PGSC0003DMG400002138 Solanum tuberosum PGSC0003DMG400002138 I 0.883
Thhalv10002472m.g Eutrema salsugineum Thhalv10002472m.g I 0.883
TRP2 Arabidopsis thaliana AT3G46590 D 0.883
Gorai.009G098300 Gossypium raimondii Gorai.009G098300 I 0.857
TRFL4 Vitis vinifera VIT_08s0007g00500 I 0.831
Cagra.1671s0374 Capsella grandiflora Cagra.1671s0374 I 0.831
TRFL9 Arabidopsis lyrata fgenesh2_kg.3__1313__AT3G12560.1 I 0.831
GLYMA11G34050 Glycine max GLYMA11G34050 I 0.831
Bra034751 Brassica rapa Bra034751 I 0.831
Carubv10013179m.g Capsella rubella Carubv10013179m.g I 0.831
Cagra.5641s0019 Capsella grandiflora Cagra.5641s0019 I 0.831
Bostr.3640s0028 Boechera stricta Bostr.3640s0028 I 0.831
Eucgr.J01245 Eucalyptus grandis Eucgr.J01245 I 0.831
Pm018821 Prunus mume Pm018821 I 0.831
Bostr.25219s0206 Boechera stricta Bostr.25219s0206 I 0.831
Carubv10011259m.g Capsella rubella Carubv10011259m.g I 0.831
evm.TU.supercontig_1.421 Carica papaya evm.TU.supercontig_1.421 I 0.831
Bra038729 Brassica rapa Bra038729 I 0.831
Ca_02624 Cicer arietinum Ca_02624 I 0.831
Ca_13309 Cicer arietinum Ca_13309 I 0.831
VIT_13s0019g01670 Vitis vinifera VIT_13s0019g01670 I 0.831
gene26492-v1.0-hybrid Fragaria vesca gene26492-v1.0-hybrid I 0.831
TRP3 Arabidopsis thaliana AT3G12560 I 0.831
POPTR_0006s08680 Populus trichocarpa POPTR_0006s08680 I 0.831
TCM_042704 Theobroma cacao TCM_042704 I 0.831
PRUPE_ppa002374mg Prunus persica PRUPE_ppa002374mg I 0.831
MTR_2g097290 Medicago truncatula MTR_2g097290 I 0.831
Thhalv10007062m.g Eutrema salsugineum Thhalv10007062m.g I 0.831
Thhalv10020283m.g Eutrema salsugineum Thhalv10020283m.g I 0.831
TRP5 Arabidopsis thaliana AT1G07540 D 0.831
MTR_3g067935 Medicago truncatula MTR_3g067935 I 0.831
GSMUA_Achr7G15090_001 Musa acuminata GSMUA_Achr7G15090_001 I 0.831
Bo01118s020 Brassica oleracea Bo01118s020 I 0.831
Bo1g139150 Brassica oleracea Bo1g139150 I 0.831
Gorai.011G266100 Gossypium raimondii Gorai.011G266100 I 0.831
Bra030689 Brassica rapa Bra030689 I 0.831
TRFL2 Arabidopsis lyrata Al_scaffold_0001_698 I 0.831
GLYMA18G04251 Glycine max GLYMA18G04251 I 0.831
Gorai.013G021300 Gossypium raimondii Gorai.013G021300 I 0.831
Bo5g133380 Brassica oleracea Bo5g133380 I 0.831
Lus10040795.g Linum usitatissimum Lus10040795.g N 0.831
Lus10016527.g Linum usitatissimum Lus10016527.g N 0.831
Bostr.18473s0300 Boechera stricta Bostr.18473s0300 I 0.823
AMTR_s00012p00239180 Amborella trichopoda AMTR_s00012p00239180 I 0.823
TRFL4 Arabidopsis lyrata Al_scaffold_0005_2280 I 0.823
Carubv10016934m.g Capsella rubella Carubv10016934m.g I 0.823
Thhalv10011058m.g Eutrema salsugineum Thhalv10011058m.g I 0.823
Pavir.Gb01315 Panicum virgatum Pavir.Gb01315 I 0.823
Cagra.0448s0008 Capsella grandiflora Cagra.0448s0008 I 0.823
TRFL4 Arabidopsis thaliana AT3G53790 I 0.823
Cucsa.165230 Cucumis sativus Cucsa.165230 I 0.823
GRMZM2G133016 Zea mays GRMZM2G133016 I 0.823
TRFL1 Arabidopsis lyrata fgenesh2_kg.5__1021__AT3G46590.3 I 0.823
Solyc05g054410.2 Solanum lycopersicum Solyc05g054410.2 I 0.823
Sb06g019970 Sorghum bicolor Sb06g019970 I 0.823
Cla004068 Citrullus lanatus Cla004068 I 0.823
mgf007893m Mimulus guttatus mgf007893m I 0.823
Si000591m.g Setaria italica Si000591m.g I 0.823
PGSC0003DMG400023432 Solanum tuberosum PGSC0003DMG400023432 I 0.823
Bo2g011570 Brassica oleracea Bo2g011570 I 0.821
Bo3g009370 Brassica oleracea Bo3g009370 I 0.821
Bra023437 Brassica rapa Bra023437 I 0.821
Lus10002704.g Linum usitatissimum Lus10002704.g I 0.821
Lus10040285.g Linum usitatissimum Lus10040285.g I 0.821
POPTR_0010s20990 Populus trichocarpa POPTR_0010s20990 I 0.821
Thhalv10012893m.g Eutrema salsugineum Thhalv10012893m.g I 0.821
MTR_5g080010 Medicago truncatula MTR_5g080010 I 0.821
LjSGA_019393.1 Lotus japonicus LjSGA_019393.1 I 0.821
SapurV1A.0451s0070 Salix purpurea SapurV1A.0451s0070 I 0.821
SapurV1A.0281s0030 Salix purpurea SapurV1A.0281s0030 I 0.821
POPTR_0008s05740 Populus trichocarpa POPTR_0008s05740 I 0.821
TRP4 Arabidopsis thaliana AT5G13820 I 0.821
MDP0000119184 Malus domestica MDP0000119184 I 0.821
Lus10000947.g Linum usitatissimum Lus10000947.g I 0.821
Bostr.2902s0116 Boechera stricta Bostr.2902s0116 I 0.821
Bo9g166400 Brassica oleracea Bo9g166400 I 0.821
Ciclev10030878m.g Citrus clementina Ciclev10030878m.g I 0.821
TBP1 Arabidopsis lyrata fgenesh2_kg.6__1339__AT5G13820.1 I 0.821
Bra006218 Brassica rapa Bra006218 I 0.821
cassava31336.valid.m1 Manihot esculenta cassava31336.valid.m1 I 0.821
Ca_16107 Cicer arietinum Ca_16107 I 0.821
Bra008800 Brassica rapa Bra008800 I 0.821
Si009551m.g Setaria italica Si009551m.g I 0.805
PGSC0003DMG400006353 Solanum tuberosum PGSC0003DMG400006353 I 0.802
Carubv10000426m.g Capsella rubella Carubv10000426m.g I 0.802
Cagra.5588s0009 Capsella grandiflora Cagra.5588s0009 I 0.802
Solyc04g011650.2 Solanum lycopersicum Solyc04g011650.2 I 0.802
Pavir.Ea04142 Panicum virgatum Pavir.Ea04142 I 0.800
Carubv10018629m.g Capsella rubella Carubv10018629m.g I 0.794
BRADI2G62170 Brachypodium distachyon BRADI2G62170 I 0.789
TRAES3BF045500220CFD_g Triticum aestivum TRAES3BF045500220CFD_g I 0.789
F775_10373 Aegilops tauschii F775_10373 I 0.789
MLOC_57410 Hordeum vulgare MLOC_57410 I 0.789
Bo5g008270 Brassica oleracea Bo5g008270 I 0.782
SELMODRAFT_123062 Selaginella moellendorffii SELMODRAFT_123062 I 0.782
Bra015585 Brassica rapa Bra015585 I 0.782
SELMODRAFT_121021 Selaginella moellendorffii SELMODRAFT_121021 I 0.782
OBART02G37370 Oryza barthii OBART02G37370 I 0.774
OPUNC02G34540 Oryza punctata OPUNC02G34540 I 0.774
ORGLA02G0325900 Oryza glaberrima ORGLA02G0325900 I 0.774
OGLUM02G38510 Oryza glumaepatula OGLUM02G38510 I 0.774
ONIVA02G40130 Oryza nivara ONIVA02G40130 I 0.774
OB02G44060 Oryza brachyantha OB02G44060 I 0.774
OMERI01G33350 Oryza meridionalis OMERI01G33350 I 0.774
OLONG_013725 Oryza longistaminata OLONG_013725 I 0.774
BGIOSGA005358 Oryza indica BGIOSGA005358 I 0.774
ORUFI02G38880 Oryza rufipogon ORUFI02G38880 I 0.774
LPERR02G30830 Leersia perrieri LPERR02G30830 I 0.774
SELMODRAFT_131544 Selaginella moellendorffii SELMODRAFT_131544 I 0.768
Pavir.J14051 Panicum virgatum Pavir.J14051 I 0.763
Traes_3DL_FCD561E40 Triticum aestivum Traes_3DL_FCD561E40 N 0.749
Cla013524 Citrullus lanatus Cla013524 I 0.742
Cucsa.138770 Cucumis sativus Cucsa.138770 I 0.742
Gorai.010G200900 Gossypium raimondii Gorai.010G200900 I 0.736
Bo4g120560 Brassica oleracea Bo4g120560 I 0.711
LjSGA_017694.1 Lotus japonicus LjSGA_017694.1 I 0.705
estExt_fgenesh1_pg.C_1140084 Physcomitrella patens estExt_fgenesh1_pg.C_1140084 N 0.671