MDP0000209974 (Malus domestica)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 MDP0000209974 T288422_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 1.000
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.979
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.979
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
MDP0000209974 Myb 582 632

Links

Other Myb/SANT family TFs
Other Malus domestica TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
30131.m006860 Ricinus communis 30131.m006860 I 0.000
FUS3 Arabidopsis thaliana AT3G26790 D 0.000
Bo00285s530 Brassica oleracea Bo00285s530 I 0.000
Bra032953 Brassica rapa Bra032953 I 0.000
cassava14836.m1 Manihot esculenta cassava14836.m1 I 0.000
Ca_05976 Cicer arietinum Ca_05976 I 0.000
Ciclev10016085m.g Citrus clementina Ciclev10016085m.g I 0.000
Cla009252 Citrullus lanatus Cla009252 I 0.000
FUS3 Arabidopsis lyrata fgenesh2_kg.5__447__AT3G26790.1 I 0.000
GLYMA16G05480 Glycine max GLYMA16G05480 I 0.000
GLYMA19G27336 Glycine max GLYMA19G27336 I 0.000
LjSGA_037319.1 Lotus japonicus LjSGA_037319.1 I 0.000
Lus10012572.g Linum usitatissimum Lus10012572.g I 0.000
mgf021117m Mimulus guttatus mgf021117m N 0.000
Pm016099 Prunus mume Pm016099 I 0.000
POPTR_0001s32990 Populus trichocarpa POPTR_0001s32990 I 0.000
POPTR_0017s08820 Populus trichocarpa POPTR_0017s08820 I 0.000
TCM_017321 Theobroma cacao TCM_017321 I 0.000