MDP0000209974 (Malus domestica)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 MDP0000209974 T288422_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 1.000
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.979
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.979
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
MDP0000209974 Myb 582 632

Links

Other Myb/SANT family TFs
Other Malus domestica TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
PHD1 Saccharomyces cerevisiae YKL043W D 0.000
SOK2 Saccharomyces cerevisiae YMR016C D 0.000
HCAG_07413 Histoplasma capsulatum HCAG_07413 D 0.000
XP_002490663.1 Pichia pastoris XP_002490663.1 I 0.000
SU7_2504 Saccharomyces arboricola SU7_2504 I 0.000
SU7_2011 Saccharomyces arboricola SU7_2011 I 0.000
SPAPADRAFT_59209 Spathaspora passalidarum SPAPADRAFT_59209 I 0.000
SNOG_14941 Phaeosphaeria nodorum SNOG_14941 I 0.000
SKUD_205603 Saccharomyces kudriavzevii SKUD_205603 I 0.000
SKUD_205409 Saccharomyces kudriavzevii SKUD_205409 I 0.000
SETTUDRAFT_91357 Setosphaeria turcica SETTUDRAFT_91357 I 0.000
PV09_05716 Verruconis gallopava PV09_05716 I 0.000
PTT_19958 Pyrenophora teres PTT_19958 I 0.000
PTRG_01883 Pyrenophora triticirepentis PTRG_01883 I 0.000
PICST_67427 Scheffersomyces stipitis PICST_67427 I 0.000
PGUG_03651 Meyerozyma guilliermondii PGUG_03651 I 0.000
PAS_chr1-4_0530 Komagataella pastoris PAS_chr1-4_0530 I 0.000
NDAI_0K01760 Naumovozyma dairenensis NDAI_0K01760 I 0.000
TDEL_0B06530 Torulaspora delbrueckii TDEL_0B06530 I 0.000
W97_03035 Coniosporium apollinis W97_03035 I 0.000
YALI0_B19602g Yarrowia lipolytica YALI0_B19602g I 0.000
SAKL0D13442g Lachancea kluyveri SAKL0D13442g I 0.000
Kwal_8176 Kluyveromyces waltii Kwal_8176 I 0.000
KLTH0D07876g Kluyveromyces thermotolerans KLTH0D07876g I 0.000
17689_YMR016C Saccharomyces bayanus 17689_YMR016C I 0.000
17269_YMR016C Saccharomyces paradoxus 17269_YMR016C I 0.000
16462_YMR016C Saccharomyces mikatae 16462_YMR016C I 0.000
14607_YKL043W Saccharomyces bayanus 14607_YKL043W I 0.000
13647_YKL043W Saccharomyces paradoxus 13647_YKL043W I 0.000
13508_YKL043W Saccharomyces mikatae 13508_YKL043W I 0.000
estExt_fgenesh1_pg.C_chr_3.10654 Pichia stipitis estExt_fgenesh1_pg.C_chr_3.10654 I 0.000
estExt_fgenesh1_pg.C_220129 Cochliobolus heterostrophus C5 estExt_fgenesh1_pg.C_220129 I 0.000
ZYRO0E06248g Zygosaccharomyces rouxii ZYRO0E06248g I 0.000
ZBAI_08486 Zygosaccharomyces bailii ZBAI_08486 I 0.000
ZBAI_03487 Zygosaccharomyces bailii ZBAI_03487 I 0.000
YALI0_D01573g Yarrowia lipolytica YALI0_D01573g I 0.000
LEMA_P011910.1 Leptosphaeria maculans LEMA_P011910.1 I 0.000
LELG_05390 Lodderomyces elongisporus LELG_05390 I 0.000
COCSADRAFT_302496 Bipolaris sorokiniana COCSADRAFT_302496 I 0.000
COCMIDRAFT_103135 Bipolaris oryzae COCMIDRAFT_103135 I 0.000
COCCADRAFT_26917 Bipolaris zeicola COCCADRAFT_26917 I 0.000
COCC4DRAFT_44406 Bipolaris maydis COCC4DRAFT_44406 I 0.000
CLUG_02047 Clavispora lusitaniae CLUG_02047 I 0.000
CD36_33560 Candida dubliniensis CD36_33560 I 0.000
CaO19.8243 Candida albicans CaO19.8243 I 0.000
CaO19.610 Candida albicans CaO19.610 I 0.000
CAGL0L01771g Candida glabrata CAGL0L01771g I 0.000
ATEG_09634 Aspergillus terreus CADATEAG00005510 I 0.000
BDDG_09856 Blastomyces dermatitidis BDDG_09856 I 0.000
AGOS_ABR055C Ashbya gossypii AGOS_ABR055C I 0.000
AACERI_AaceriABR055C Saccharomycetaceae sp ashbya aceri AACERI_AaceriABR055C I 0.000
SNOG_14941 Stagonospora nodorum SNOG_14941 I 0.000
PGUG_03651 Candida guilliermondii PGUG_03651 I 0.000
CPAG_00178 Candida parapsilosis CPAG_00178 I 0.000
COCVIDRAFT_16107 Bipolaris victoriae COCVIDRAFT_16107 I 0.000
CORT_0G01760 Candida orthopsilosis CORT_0G01760 I 0.000
LALA0_S02e00628g Lachancea lanzarotensis LALA0_S02e00628g I 0.000
KUCA_T00004103001 Kuraishia capsulata KUCA_T00004103001 I 0.000
KLTH0D07876g Lachancea thermotolerans KLTH0D07876g I 0.000
KLLA0_F04840g Kluyveromyces lactis KLLA0_F04840g I 0.000
KAFR_0B01410 Kazachstania africana KAFR_0B01410 I 0.000
KAFR_0A02120 Kazachstania africana KAFR_0A02120 I 0.000
JL09_g3139 Pichia kudriavzevii JL09_g3139 I 0.000
HPODL_04965 Ogataea parapolymorpha HPODL_04965 I 0.000
HPODL_01835 Ogataea parapolymorpha HPODL_01835 I 0.000
HCBG_04638 Histoplasma capsulatum HCBG_04638 I 0.000
GNLVRS01_PISO0F15757g Millerozyma farinosa GNLVRS01_PISO0F15757g I 0.000
GNLVRS01_PISO0E14370g Millerozyma farinosa GNLVRS01_PISO0E14370g I 0.000
G210_4810 Candida maltosa G210_4810 I 0.000
EV44_g0662 Erysiphe necator EV44_g0662 I 0.000
Ecym_4584 Eremothecium cymbalariae Ecym_4584 I 0.000
DEHA2E10978g Debaryomyces hansenii DEHA2E10978g I 0.000
CLUG_02047 Candida lusitaniae CLUG_02047 I 0.000