Pavir.J18132 (Panicum virgatum)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 Pavir.J18132 T289395_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.936
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.936
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pavir.J18132.1.p Myb 582 632

Links

Other Myb/SANT family TFs
Other Panicum virgatum TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACLA_002790 Aspergillus clavatus CADACLAG00000095 I 0.000
CADAFLAG00004208 Aspergillus flavus CADAFLAG00004208 N 0.000
CADAFLAG00010229 Aspergillus flavus CADAFLAG00010229 I 0.000
CADAFLAG00012923 Aspergillus flavus CADAFLAG00012923 N 0.000
CADANGAG00002855 Aspergillus niger CADANGAG00002855 N 0.000
CADANGAG00013253 Aspergillus niger CADANGAG00013253 I 0.000
CADAORAG00009408 Aspergillus oryzae CADAORAG00009408 I 0.000
e_gw1.00162.87.1 Aspergillus carbonarius e_gw1.00162.87.1 N 0.000
fgenesh1_pm.00855_#_253 Aspergillus carbonarius fgenesh1_pm.00855_#_253 I 0.000