Thhalv10020283m.g (Eutrema salsugineum)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 Thhalv10020283m.g T290106_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.849 0.979
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.841 0.957
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.841 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.831 0.936
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Thhalv10020283m Myb 527 577

Links

Other Myb/SANT family TFs
Other Eutrema salsugineum TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Bo5g133380 Brassica oleracea Bo5g133380 I 0.909
Eucgr.J01245 Eucalyptus grandis Eucgr.J01245 I 0.909
TCM_042704 Theobroma cacao TCM_042704 I 0.909
VIT_13s0019g01670 Vitis vinifera VIT_13s0019g01670 I 0.909
GLYMA18G04251 Glycine max GLYMA18G04251 I 0.909
GLYMA11G34050 Glycine max GLYMA11G34050 I 0.909
evm.TU.supercontig_1.421 Carica papaya evm.TU.supercontig_1.421 I 0.909
Bra034751 Brassica rapa Bra034751 I 0.909
Gorai.013G021300 Gossypium raimondii Gorai.013G021300 I 0.909
TRFL9 Arabidopsis lyrata fgenesh2_kg.3__1313__AT3G12560.1 I 0.909
Gorai.011G266100 Gossypium raimondii Gorai.011G266100 I 0.909
Bra038729 Brassica rapa Bra038729 I 0.909
Bo1g139150 Brassica oleracea Bo1g139150 I 0.909
Ca_13309 Cicer arietinum Ca_13309 I 0.909
TRP3 Arabidopsis thaliana AT3G12560 I 0.909
MTR_3g067935 Medicago truncatula MTR_3g067935 I 0.909
Bostr.3640s0028 Boechera stricta Bostr.3640s0028 I 0.909
PRUPE_ppa002374mg Prunus persica PRUPE_ppa002374mg I 0.909
Carubv10013179m.g Capsella rubella Carubv10013179m.g I 0.909
Cagra.5641s0019 Capsella grandiflora Cagra.5641s0019 I 0.909
Cla004068 Citrullus lanatus Cla004068 I 0.901
Cucsa.165230 Cucumis sativus Cucsa.165230 I 0.901
MTR_5g080010 Medicago truncatula MTR_5g080010 I 0.899
Lus10002704.g Linum usitatissimum Lus10002704.g I 0.899
TBP1 Arabidopsis lyrata fgenesh2_kg.6__1339__AT5G13820.1 I 0.899
Ca_16107 Cicer arietinum Ca_16107 I 0.899
Ciclev10030878m.g Citrus clementina Ciclev10030878m.g I 0.899
Bostr.2902s0116 Boechera stricta Bostr.2902s0116 I 0.899
Lus10000947.g Linum usitatissimum Lus10000947.g I 0.899
Thhalv10012893m.g Eutrema salsugineum Thhalv10012893m.g I 0.899
Bo9g166400 Brassica oleracea Bo9g166400 I 0.899
Bo3g009370 Brassica oleracea Bo3g009370 I 0.899
Bo2g011570 Brassica oleracea Bo2g011570 I 0.899
POPTR_0008s05740 Populus trichocarpa POPTR_0008s05740 I 0.899
TRP4 Arabidopsis thaliana AT5G13820 I 0.899
MDP0000119184 Malus domestica MDP0000119184 I 0.899
LjSGA_019393.1 Lotus japonicus LjSGA_019393.1 I 0.899
SapurV1A.0451s0070 Salix purpurea SapurV1A.0451s0070 I 0.899
Bra023437 Brassica rapa Bra023437 I 0.899
Lus10040285.g Linum usitatissimum Lus10040285.g I 0.899
Bra006218 Brassica rapa Bra006218 I 0.899
Bra008800 Brassica rapa Bra008800 I 0.899
Pm018821 Prunus mume Pm018821 I 0.891
SapurV1A.0281s0030 Salix purpurea SapurV1A.0281s0030 I 0.881
POPTR_0010s20990 Populus trichocarpa POPTR_0010s20990 I 0.881
Carubv10000426m.g Capsella rubella Carubv10000426m.g I 0.880
Cagra.5588s0009 Capsella grandiflora Cagra.5588s0009 I 0.880
Pm000720 Prunus mume Pm000720 I 0.849
TRFL2 Arabidopsis lyrata Al_scaffold_0001_698 I 0.849
cassava19452.valid.m1 Manihot esculenta cassava19452.valid.m1 I 0.849
cassava19451.valid.m1 Manihot esculenta cassava19451.valid.m1 I 0.849
28880.m000016 Ricinus communis 28880.m000016 I 0.849
Si034524m.g Setaria italica Si034524m.g I 0.849
Pm002686 Prunus mume Pm002686 I 0.849
Solyc06g076270.2 Solanum lycopersicum Solyc06g076270.2 I 0.849
TRIUR3_18647 Triticum urartu TRIUR3_18647 I 0.849
cassava19453.valid.m1 Manihot esculenta cassava19453.valid.m1 I 0.849
Traes_4BL_AB2636FB0 Triticum aestivum Traes_4BL_AB2636FB0 I 0.849
VIT_06s0004g04940 Vitis vinifera VIT_06s0004g04940 I 0.849
Traes_4AS_FA7E65184 Triticum aestivum Traes_4AS_FA7E65184 I 0.849
Traes_4DL_3849A9A5F Triticum aestivum Traes_4DL_3849A9A5F I 0.849
Ca_02624 Cicer arietinum Ca_02624 I 0.849
TCM_041816 Theobroma cacao TCM_041816 I 0.849
Cla008361 Citrullus lanatus Cla008361 I 0.849
Carubv10026172m.g Capsella rubella Carubv10026172m.g I 0.849
MDP0000137531 Malus domestica MDP0000137531 I 0.849
MDP0000209974 Malus domestica MDP0000209974 I 0.849
Lus10024385.g Linum usitatissimum Lus10024385.g I 0.849
Lus10010844.g Linum usitatissimum Lus10010844.g I 0.849
Gorai.003G130700 Gossypium raimondii Gorai.003G130700 I 0.849
orange1.1g042386m.g Citrus sinensis orange1.1g042386m.g I 0.849
Pavir.Ia03771 Panicum virgatum Pavir.Ia03771 I 0.849
Thhalv10013086m.g Eutrema salsugineum Thhalv10013086m.g I 0.849
PK21687.1 Cannabis sativa PK21687.1 D 0.849
Thhalv10007062m.g Eutrema salsugineum Thhalv10007062m.g I 0.849
SapurV1A.0041s0150 Salix purpurea SapurV1A.0041s0150 I 0.849
Pavir.J18132 Panicum virgatum Pavir.J18132 I 0.849
evm.TU.supercontig_81.127 Carica papaya evm.TU.supercontig_81.127 I 0.849
Eucgr.B02351 Eucalyptus grandis Eucgr.B02351 I 0.849
Aquca_009_00956 Aquilegia coerulea Aquca_009_00956 I 0.849
Bostr.25219s0206 Boechera stricta Bostr.25219s0206 I 0.849
mgf005791m Mimulus guttatus mgf005791m I 0.849
e_gw1.132.51.1 Physcomitrella patens e_gw1.132.51.1 I 0.849
Cucsa.117790 Cucumis sativus Cucsa.117790 I 0.849
Bostr.26833s0301 Boechera stricta Bostr.26833s0301 I 0.849
Cagra.1317s0071 Capsella grandiflora Cagra.1317s0071 I 0.849
Ciclev10027927m.g Citrus clementina Ciclev10027927m.g I 0.849
Sb01g039650 Sorghum bicolor Sb01g039650 I 0.849
Carubv10011259m.g Capsella rubella Carubv10011259m.g I 0.849
Cagra.1671s0374 Capsella grandiflora Cagra.1671s0374 I 0.849
cassava30955.valid.m1 Manihot esculenta cassava30955.valid.m1 I 0.849
Si016548m.g Setaria italica Si016548m.g I 0.849
OGLUM03G12230 Oryza glumaepatula OGLUM03G12230 I 0.849
OBART03G12240 Oryza barthii OBART03G12240 I 0.849
OB03G22340 Oryza brachyantha OB03G22340 I 0.849
MLOC_59817 Hordeum vulgare MLOC_59817 I 0.849
OLONG_025333 Oryza longistaminata OLONG_025333 I 0.849
OMERI03G11490 Oryza meridionalis OMERI03G11490 I 0.849
ORGLA03G0118300 Oryza glaberrima ORGLA03G0118300 I 0.849
OPUNC03G11810 Oryza punctata OPUNC03G11810 I 0.849
ONIVA11G13450 Oryza nivara ONIVA11G13450 I 0.849
GSMUA_Achr9G03910_001 Musa acuminata GSMUA_Achr9G03910_001 I 0.849
GSMUA_Achr7G15090_001 Musa acuminata GSMUA_Achr7G15090_001 I 0.849
Bra030689 Brassica rapa Bra030689 I 0.849
Bo01118s020 Brassica oleracea Bo01118s020 I 0.849
BGIOSGA012326 Oryza indica BGIOSGA012326 I 0.849
TRP5 Arabidopsis thaliana AT1G07540 D 0.849
BRADI1G66677 Brachypodium distachyon BRADI1G66677 I 0.849
F775_17181 Aegilops tauschii F775_17181 I 0.849
GRMZM2G110309 Zea mays GRMZM2G110309 I 0.849
GRMZM2G063151 Zea mays GRMZM2G063151 I 0.849
GLYMA13G41210 Glycine max GLYMA13G41210 I 0.849
ORUFI03G12870 Oryza rufipogon ORUFI03G12870 I 0.849
LPERR03G10840 Leersia perrieri LPERR03G10840 I 0.849
PGSC0003DMG400030324 Solanum tuberosum PGSC0003DMG400030324 I 0.849
POPTR_0001s24840 Populus trichocarpa POPTR_0001s24840 I 0.849
POPTR_0009s03730 Populus trichocarpa POPTR_0009s03730 I 0.849
PRUPE_ppa002403mg Prunus persica PRUPE_ppa002403mg I 0.849
PRUPE_ppa002522mg Prunus persica PRUPE_ppa002522mg I 0.849
OS03G0274300 Oryza sativa OS03G0274300 I 0.849
TRFL1 Arabidopsis lyrata fgenesh2_kg.5__1021__AT3G46590.3 I 0.841
Cagra.0448s0008 Capsella grandiflora Cagra.0448s0008 I 0.841
mgf007893m Mimulus guttatus mgf007893m I 0.841
Solyc05g054410.2 Solanum lycopersicum Solyc05g054410.2 I 0.841
gene02230-v1.0-hybrid Fragaria vesca gene02230-v1.0-hybrid I 0.841
GLYMA07G15940 Glycine max GLYMA07G15940 I 0.841
GLYMA18G39911 Glycine max GLYMA18G39911 I 0.841
Carubv10016934m.g Capsella rubella Carubv10016934m.g I 0.841
Solyc06g005590.2 Solanum lycopersicum Solyc06g005590.2 I 0.841
MTR_7g061840 Medicago truncatula MTR_7g061840 I 0.841
TRP2 Arabidopsis thaliana AT3G46590 D 0.841
PGSC0003DMG400002138 Solanum tuberosum PGSC0003DMG400002138 I 0.841
Ca_21136 Cicer arietinum Ca_21136 I 0.841
PGSC0003DMG400023432 Solanum tuberosum PGSC0003DMG400023432 I 0.841
Thhalv10002472m.g Eutrema salsugineum Thhalv10002472m.g I 0.841
cassava31336.valid.m1 Manihot esculenta cassava31336.valid.m1 I 0.839
POPTR_0006s08680 Populus trichocarpa POPTR_0006s08680 I 0.831
GLYMA11G14760 Glycine max GLYMA11G14760 I 0.831
GSMUA_Achr8G20810_001 Musa acuminata GSMUA_Achr8G20810_001 I 0.831
GSMUA_Achr10G22620_001 Musa acuminata GSMUA_Achr10G22620_001 I 0.831
Gorai.006G172000 Gossypium raimondii Gorai.006G172000 I 0.831
GLYMA15G04200 Glycine max GLYMA15G04200 I 0.831
TRFL4 Vitis vinifera VIT_08s0007g00500 I 0.831
AMTR_s00009p00107000 Amborella trichopoda AMTR_s00009p00107000 I 0.831
ATTRP1 Arabidopsis lyrata fgenesh2_kg.8__1886__AT5G59430.4 I 0.831
TRP1 Arabidopsis thaliana AT5G59430 D 0.831
SapurV1A.0040s0420 Salix purpurea SapurV1A.0040s0420 I 0.831
gene26492-v1.0-hybrid Fragaria vesca gene26492-v1.0-hybrid I 0.831
MTR_2g097290 Medicago truncatula MTR_2g097290 I 0.831
TCM_021921 Theobroma cacao TCM_021921 I 0.831
Bo9g139390 Brassica oleracea Bo9g139390 I 0.823
GLYMA12G06680 Glycine max GLYMA12G06680 I 0.823
TRFL4 Arabidopsis lyrata Al_scaffold_0005_2280 I 0.823
gene18432-v1.0-hybrid Fragaria vesca gene18432-v1.0-hybrid I 0.823
Pavir.Gb01315 Panicum virgatum Pavir.Gb01315 I 0.823
Bra002566 Brassica rapa Bra002566 I 0.823
Bostr.18473s0300 Boechera stricta Bostr.18473s0300 I 0.823
Aquca_003_00096 Aquilegia coerulea Aquca_003_00096 I 0.823
Si000591m.g Setaria italica Si000591m.g I 0.823
Sb06g019970 Sorghum bicolor Sb06g019970 I 0.823
TRFL4 Arabidopsis thaliana AT3G53790 I 0.823
Thhalv10011058m.g Eutrema salsugineum Thhalv10011058m.g I 0.823
GRMZM2G133016 Zea mays GRMZM2G133016 I 0.823
gw1.98.100.1 Physcomitrella patens gw1.98.100.1 I 0.823
AMTR_s00012p00239180 Amborella trichopoda AMTR_s00012p00239180 I 0.823
Solyc04g011650.2 Solanum lycopersicum Solyc04g011650.2 I 0.820
Gorai.010G200900 Gossypium raimondii Gorai.010G200900 I 0.814
Si009551m.g Setaria italica Si009551m.g I 0.805
PGSC0003DMG400006353 Solanum tuberosum PGSC0003DMG400006353 I 0.802
Bra015585 Brassica rapa Bra015585 I 0.800
Bo5g008270 Brassica oleracea Bo5g008270 I 0.800
Pavir.Ea04142 Panicum virgatum Pavir.Ea04142 I 0.800
Gorai.009G098300 Gossypium raimondii Gorai.009G098300 I 0.794
BGIOSGA005358 Oryza indica BGIOSGA005358 I 0.792
OLONG_013725 Oryza longistaminata OLONG_013725 I 0.792
OMERI01G33350 Oryza meridionalis OMERI01G33350 I 0.792
ONIVA02G40130 Oryza nivara ONIVA02G40130 I 0.792
ORGLA02G0325900 Oryza glaberrima ORGLA02G0325900 I 0.792
OPUNC02G34540 Oryza punctata OPUNC02G34540 I 0.792
ORUFI02G38880 Oryza rufipogon ORUFI02G38880 I 0.792
OGLUM02G38510 Oryza glumaepatula OGLUM02G38510 I 0.792
LPERR02G30830 Leersia perrieri LPERR02G30830 I 0.792
OB02G44060 Oryza brachyantha OB02G44060 I 0.792
OBART02G37370 Oryza barthii OBART02G37370 I 0.792
MLOC_57410 Hordeum vulgare MLOC_57410 I 0.789
F775_10373 Aegilops tauschii F775_10373 I 0.789
BRADI2G62170 Brachypodium distachyon BRADI2G62170 I 0.789
TRAES3BF045500220CFD_g Triticum aestivum TRAES3BF045500220CFD_g I 0.789
SELMODRAFT_121021 Selaginella moellendorffii SELMODRAFT_121021 I 0.782
SELMODRAFT_123062 Selaginella moellendorffii SELMODRAFT_123062 I 0.782
LjSGA_017694.1 Lotus japonicus LjSGA_017694.1 I 0.765
Pavir.J14051 Panicum virgatum Pavir.J14051 I 0.763
Cla013524 Citrullus lanatus Cla013524 I 0.760
Cucsa.138770 Cucumis sativus Cucsa.138770 I 0.760
Carubv10018629m.g Capsella rubella Carubv10018629m.g I 0.734
Bo4g120560 Brassica oleracea Bo4g120560 I 0.711
SELMODRAFT_131544 Selaginella moellendorffii SELMODRAFT_131544 I 0.708