AMTR_s00047p00199030 (Amborella trichopoda)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 AMTR_s00047p00199030 T326429_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.695 0.756
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.695 0.756
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.688 0.733
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.653 0.689
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.653 0.689
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.589 0.644
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
ERN17844 Sox 104 148

Links

Other Sox family TFs
Other Amborella trichopoda TFs

520 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
mgf007067m Mimulus guttatus mgf007067m I 0.730
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.724
Cla010397 Citrullus lanatus Cla010397 I 0.724
30174.m009083 Ricinus communis 30174.m009083 I 0.724
PK13838.1 Cannabis sativa PK13838.1 I 0.724
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.724
TCM_011484 Theobroma cacao TCM_011484 I 0.724
CRC Vitis vinifera VIT_01s0011g00140 I 0.724
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.724
Ca_12379 Cicer arietinum Ca_12379 I 0.724
Ca_18533 Cicer arietinum Ca_18533 I 0.724
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.724
Pm030598 Prunus mume Pm030598 I 0.724
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.724
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.724
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.724
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.724
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.724
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.724
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.724
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.724
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.718
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.718
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.718
MDP0000171878 Malus domestica MDP0000171878 I 0.701
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.699
OB03G18700 Oryza brachyantha OB03G18700 I 0.699
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.699
OBART03G08320 Oryza barthii OBART03G08320 I 0.699
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.699
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.699
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.699
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.699
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.699
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.699
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.699
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.699
Si037608m.g Setaria italica Si037608m.g I 0.699
OS03G0215200 Oryza sativa OS03G0215200 I 0.699
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.699
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.699
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.699
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.699
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.699
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.699
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.699
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.699
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.699
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.699
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.698
Bo6g108630 Brassica oleracea Bo6g108630 I 0.695
MDP0000124879 Malus domestica MDP0000124879 I 0.695
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.695
CRC Arabidopsis thaliana AT1G69180 D 0.695
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.695
MDP0000291729 Malus domestica MDP0000291729 I 0.695
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.695
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.695
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.695
Bra004364 Brassica rapa Bra004364 I 0.695
Bo8g055830 Brassica oleracea Bo8g055830 I 0.694
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.692
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.692
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.692
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.692
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.692
mgf001016m Mimulus guttatus mgf001016m I 0.691
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.688
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.688
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.688
Bra003309 Brassica rapa Bra003309 I 0.688
Bra030728 Brassica rapa Bra030728 I 0.688
Bra037320 Brassica rapa Bra037320 I 0.688
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.688
Bo4g195410 Brassica oleracea Bo4g195410 I 0.688
Bra018624 Brassica rapa Bra018624 I 0.688
Bo3g037630 Brassica oleracea Bo3g037630 I 0.688
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.688
Bo8g112450 Brassica oleracea Bo8g112450 I 0.688
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.688
Bo9g001130 Brassica oleracea Bo9g001130 I 0.688
MDP0000500810 Malus domestica MDP0000500810 I 0.688
AFO Arabidopsis lyrata scaffold_403460.1 I 0.688
YAB3 Arabidopsis thaliana AT4G00180 I 0.688
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.688
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.688
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.688
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.688
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.688
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.688
Bra000378 Brassica rapa Bra000378 I 0.688
Bra040322 Brassica rapa Bra040322 I 0.688
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.688
Bo6g073320 Brassica oleracea Bo6g073320 I 0.688
MDP0000366291 Malus domestica MDP0000366291 I 0.688
Bo5g009010 Brassica oleracea Bo5g009010 I 0.688
Bra031629 Brassica rapa Bra031629 I 0.688
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.688
YAB1 Arabidopsis thaliana AT2G45190 D 0.688
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.688
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.686
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.686
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.686
MDP0000331808 Malus domestica MDP0000331808 I 0.683
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.683
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.683
OB07G12810 Oryza brachyantha OB07G12810 I 0.683
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.683
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.683
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.683
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.683
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.683
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.683
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.683
OB03G35470 Oryza brachyantha OB03G35470 I 0.683
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.683
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.683
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.683
OBART03G27740 Oryza barthii OBART03G27740 I 0.683
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.683
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.683
OB12G26050 Oryza brachyantha OB12G26050 I 0.683
OBART12G19190 Oryza barthii OBART12G19190 I 0.683
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.683
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.683
Si037789m.g Setaria italica Si037789m.g I 0.683
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.683
YAB2 Arabidopsis thaliana AT1G08465 I 0.683
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.683
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.683
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.683
YAB2 Oryza sativa OS03G0650000 I 0.683
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.683
Si023308m.g Setaria italica Si023308m.g I 0.683
YAB6 Oryza sativa OS12G0621100 I 0.683
Si030811m.g Setaria italica Si030811m.g I 0.683
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.683
YAB1 Oryza sativa OS07G0160100 I 0.683
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.683
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.683
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.683
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.683
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.683
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.683
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.683
TCM_041175 Theobroma cacao TCM_041175 I 0.683
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.683
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.683
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.683
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.683
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.683
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.683
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.683
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.683
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.683
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.683
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.683
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.683
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.683
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.683
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.683
29854.m001136 Ricinus communis 29854.m001136 I 0.683
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.683
mgf009982m Mimulus guttatus mgf009982m I 0.683
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.683
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.683
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.683
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.683
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.683
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.683
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.683
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.683
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.683
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.683
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.683
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.683
F775_28710 Aegilops tauschii F775_28710 I 0.683
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.683
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.683
MDP0000252640 Malus domestica MDP0000252640 I 0.683
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.683
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.683
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.683
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.683
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.683
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.683
PK06964.1 Cannabis sativa PK06964.1 I 0.683
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.683
Pm001547 Prunus mume Pm001547 I 0.683
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.683
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.683
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.683
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.683
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.683
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.683
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.683
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.683
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.683
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.683
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.683
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.683
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.683
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.683
Cla008752 Citrullus lanatus Cla008752 I 0.683
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.683
Ca_07101 Cicer arietinum Ca_07101 I 0.683
mgf019496m Mimulus guttatus mgf019496m I 0.683
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.683
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.675
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.673
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.673
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.673
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.673
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.672
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.672
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.668
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.668
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.666
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.663
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.663
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.663
INO Vitis vinifera VIT_01s0127g00330 I 0.662
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.662
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.662
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.659
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.659
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.659
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.659
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.659
28200.m000191 Ricinus communis 28200.m000191 I 0.659
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.659
Pm017846 Prunus mume Pm017846 I 0.659
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.659
mgf011463m Mimulus guttatus mgf011463m I 0.659
30174.m008839 Ricinus communis 30174.m008839 I 0.659
mgf003166m Mimulus guttatus mgf003166m I 0.659
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.659
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.659
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.659
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.659
Ca_25981 Cicer arietinum Ca_25981 I 0.659
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.659
TCM_016030 Theobroma cacao TCM_016030 I 0.659
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.659
TCM_005549 Theobroma cacao TCM_005549 I 0.659
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.659
Si036788m.g Setaria italica Si036788m.g I 0.659
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.659
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.659
mgf015806m Mimulus guttatus mgf015806m I 0.659
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.659
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.659
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.659
Si018146m.g Setaria italica Si018146m.g I 0.659
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.659
F775_27799 Aegilops tauschii F775_27799 I 0.659
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.659
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.659
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.659
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.659
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.659
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.659
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.659
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.659
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.659
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.659
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.659
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.659
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.659
OBART10G15260 Oryza barthii OBART10G15260 I 0.659
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.659
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.659
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.659
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.659
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.659
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.659
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.659
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.659
OB02G33040 Oryza brachyantha OB02G33040 I 0.659
OBART02G25670 Oryza barthii OBART02G25670 I 0.659
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.659
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.659
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.659
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.659
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.659
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.659
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.659
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.659
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.659
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.659
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.659
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.659
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.659
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.659
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.659
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.659
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.659
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.659
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.659
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.659
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.659
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.659
YAB4 Oryza sativa OS02G0643200 I 0.659
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.659
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.659
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.659
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.659
YAB3 Oryza sativa OS10G0508300 I 0.659
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.659
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.654
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.654
F775_25525 Aegilops tauschii F775_25525 I 0.654
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.654
Pm023555 Prunus mume Pm023555 I 0.654
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.654
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.654
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.654
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.654
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.654
MDP0000192940 Malus domestica MDP0000192940 I 0.654
Cla011745 Citrullus lanatus Cla011745 I 0.654
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.654
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.654
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.654
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.654
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.654
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.654
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.654
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.654
YAB5 Oryza sativa OS04G0536300 I 0.654
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.654
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.654
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.654
Si010859m.g Setaria italica Si010859m.g I 0.654
MDP0000298333 Malus domestica MDP0000298333 I 0.654
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.654
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.654
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.654
OBART04G20010 Oryza barthii OBART04G20010 I 0.654
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.654
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.654
OB04G27010 Oryza brachyantha OB04G27010 I 0.654
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.653
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.653
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.653
YAB5 Arabidopsis thaliana AT2G26580 D 0.653
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.653
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.653
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.653
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.653
PK09461.1 Cannabis sativa PK09461.1 I 0.653
MDP0000255415 Malus domestica MDP0000255415 I 0.653
mgf010765m Mimulus guttatus mgf010765m I 0.653
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.653
mgf015972m Mimulus guttatus mgf015972m I 0.653
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.653
Bo3g041840 Brassica oleracea Bo3g041840 I 0.653
Bra000538 Brassica rapa Bra000538 I 0.653
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.653
Ca_06681 Cicer arietinum Ca_06681 I 0.653
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.653
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.653
TCM_038105 Theobroma cacao TCM_038105 I 0.653
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.653
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.653
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.653
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.653
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.653
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.653
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.653
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.653
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.653
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.653
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.653
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.653
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.653
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.653
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.653
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.653
Pm027559 Prunus mume Pm027559 I 0.653
29927.m000626 Ricinus communis 29927.m000626 I 0.653
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.653
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.653
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.653
Cla016962 Citrullus lanatus Cla016962 I 0.653
Cla012424 Citrullus lanatus Cla012424 I 0.653
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.653
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.653
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.647
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.647
TCM_031868 Theobroma cacao TCM_031868 I 0.647
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.646
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.643
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.640
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.639
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.639
Cla005767 Citrullus lanatus Cla005767 I 0.634
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.633
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.633
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.633
Pm006709 Prunus mume Pm006709 I 0.633
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.633
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.633
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.633
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.633
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.633
MDP0000126221 Malus domestica MDP0000126221 I 0.630
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.630
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.630
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.630
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.625
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.625
MDP0000263713 Malus domestica MDP0000263713 I 0.625
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.619
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.618
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.617
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.613
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.611
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.611
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.610
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.605
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.603
Ca_21472 Cicer arietinum Ca_21472 I 0.602
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.601
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.600
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.595
Cla000824 Citrullus lanatus Cla000824 I 0.595
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.589
Bra024599 Brassica rapa Bra024599 I 0.589
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.589
INO Arabidopsis thaliana AT1G23420 D 0.589
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.589
Bo7g056180 Brassica oleracea Bo7g056180 I 0.589
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.589
Bra012373 Brassica rapa Bra012373 I 0.589
Bo5g039580 Brassica oleracea Bo5g039580 I 0.589
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
OB07G25220 Oryza brachyantha OB07G25220 I 0.573
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.573
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.573
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.573
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.573
mgf023167m Mimulus guttatus mgf023167m I 0.569
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.568
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.567
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.561
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
Cla010239 Citrullus lanatus Cla010239 I 0.560
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.557
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.551
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.551
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.547
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.540
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.537
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.533
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.523
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.519
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.519
29631.m001046 Ricinus communis 29631.m001046 I 0.514
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.512
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.509
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.507
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.500
Moror_16065 Moniliophthora roreri Moror_16065 I 0.487
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.476
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.468
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.463
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.462
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.460
CND03770 Cryptococcus neoformans CND03770 I 0.460
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.453
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.453
THITE_22048 Thielavia terrestris THITE_22048 I 0.451
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.449
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.449
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.445
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.444
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.439
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.439
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.439
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.439
Si007288m.g Setaria italica Si007288m.g I 0.439
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.436
PV09_07652 Verruconis gallopava PV09_07652 I 0.434
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
UM06001 Ustilago maydis UM06001 I 0.430
sr16632 Sporisorium reilianum sr16632 I 0.430
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
TRIVIDRAFT_16124 Trichoderma virens TRIVIDRAFT_16124 N 0.427
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.426
UV8b_7580 Ustilaginoidea virens UV8b_7580 N 0.423
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
MDOA001488 Musca domestica MDOA001488 I 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GB50764 Apis mellifera GB50764 I 0.420
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
ACRE_034400 Acremonium chrysogenum ACRE_034400 N 0.419
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
PEQ_0000212901 Parascaris equorum PEQ_0000212901 N 0.417
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
KGM_20190 Danaus plexippus KGM_20190 I 0.416
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415