BRADI3G30410 (Brachypodium distachyon)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 BRADI3G30410 T326731_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.712 0.977
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.678 0.909
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.678 0.909
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
BRADI3G30410.1 Sox 226 269

Links

Other Sox family TFs
Other Brachypodium distachyon TFs

529 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.741
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.741
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.741
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.741
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.741
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.741
YAB4 Oryza sativa OS02G0643200 I 0.741
YAB3 Oryza sativa OS10G0508300 I 0.741
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.741
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.741
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.741
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.741
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.741
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.741
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.741
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.741
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.741
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.741
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.741
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.741
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.741
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.741
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.741
OB02G33040 Oryza brachyantha OB02G33040 I 0.741
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.741
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.741
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.741
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.741
OBART02G25670 Oryza barthii OBART02G25670 I 0.741
OBART10G15260 Oryza barthii OBART10G15260 I 0.741
Si036788m.g Setaria italica Si036788m.g I 0.741
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.741
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.741
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.741
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.741
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.741
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.741
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.741
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.741
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.741
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.741
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.741
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.741
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.741
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.741
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.741
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.741
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.741
Ca_25981 Cicer arietinum Ca_25981 I 0.741
Pm017846 Prunus mume Pm017846 I 0.741
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.741
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.741
TCM_005549 Theobroma cacao TCM_005549 I 0.741
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.741
28200.m000191 Ricinus communis 28200.m000191 I 0.741
30174.m008839 Ricinus communis 30174.m008839 I 0.741
mgf011463m Mimulus guttatus mgf011463m I 0.741
mgf015806m Mimulus guttatus mgf015806m I 0.741
mgf003166m Mimulus guttatus mgf003166m I 0.741
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.741
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.741
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.741
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.741
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.741
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.737
MDP0000192940 Malus domestica MDP0000192940 I 0.737
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.737
Pm023555 Prunus mume Pm023555 I 0.737
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.737
Cla011745 Citrullus lanatus Cla011745 I 0.737
MDP0000298333 Malus domestica MDP0000298333 I 0.737
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.737
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.737
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.735
Bo9g001130 Brassica oleracea Bo9g001130 I 0.712
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.712
Bra000378 Brassica rapa Bra000378 I 0.712
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.712
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.712
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.712
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.712
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.712
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.712
AFO Arabidopsis lyrata scaffold_403460.1 I 0.712
Bo5g009010 Brassica oleracea Bo5g009010 I 0.712
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.712
Bo6g073320 Brassica oleracea Bo6g073320 I 0.712
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.712
Bo8g112450 Brassica oleracea Bo8g112450 I 0.712
Bo3g037630 Brassica oleracea Bo3g037630 I 0.712
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.712
Bo4g195410 Brassica oleracea Bo4g195410 I 0.712
YAB3 Arabidopsis thaliana AT4G00180 I 0.712
Bra003309 Brassica rapa Bra003309 I 0.712
YAB1 Arabidopsis thaliana AT2G45190 D 0.712
Bra030728 Brassica rapa Bra030728 I 0.712
Bra040322 Brassica rapa Bra040322 I 0.712
Bra031629 Brassica rapa Bra031629 I 0.712
Bra037320 Brassica rapa Bra037320 I 0.712
Bra018624 Brassica rapa Bra018624 I 0.712
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.712
MDP0000366291 Malus domestica MDP0000366291 I 0.712
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.712
MDP0000500810 Malus domestica MDP0000500810 I 0.712
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.712
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.712
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.708
Si030811m.g Setaria italica Si030811m.g I 0.708
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.708
OB07G12810 Oryza brachyantha OB07G12810 I 0.708
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.708
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.708
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.708
TCM_041175 Theobroma cacao TCM_041175 I 0.708
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.708
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.708
YAB1 Oryza sativa OS07G0160100 I 0.708
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.708
PK06964.1 Cannabis sativa PK06964.1 I 0.708
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.708
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.708
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.708
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.708
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.708
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.708
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.708
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.708
YAB2 Arabidopsis thaliana AT1G08465 I 0.708
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.708
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.708
MDP0000331808 Malus domestica MDP0000331808 I 0.708
MDP0000252640 Malus domestica MDP0000252640 I 0.708
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.708
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.708
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.708
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.708
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.708
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.708
29854.m001136 Ricinus communis 29854.m001136 I 0.708
Pm001547 Prunus mume Pm001547 I 0.708
Cla008752 Citrullus lanatus Cla008752 I 0.708
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.708
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.708
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.708
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.708
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.708
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.708
Ca_07101 Cicer arietinum Ca_07101 I 0.708
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.708
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.708
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.708
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.708
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.708
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.708
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.708
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.708
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.708
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.707
Si018146m.g Setaria italica Si018146m.g I 0.707
F775_27799 Aegilops tauschii F775_27799 I 0.707
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.707
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.707
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.707
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.707
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.707
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.707
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.707
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.707
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.707
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.707
TCM_016030 Theobroma cacao TCM_016030 I 0.707
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.707
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.707
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.707
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.707
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.707
Bo8g055830 Brassica oleracea Bo8g055830 I 0.706
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.702
F775_25525 Aegilops tauschii F775_25525 I 0.702
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.702
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.702
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.702
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.702
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.702
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.702
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.702
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.702
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.702
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.702
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.702
Si010859m.g Setaria italica Si010859m.g I 0.702
Si023308m.g Setaria italica Si023308m.g I 0.702
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.702
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.702
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.702
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.702
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.702
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.702
Si037789m.g Setaria italica Si037789m.g I 0.702
YAB5 Oryza sativa OS04G0536300 I 0.702
YAB2 Oryza sativa OS03G0650000 I 0.702
YAB6 Oryza sativa OS12G0621100 I 0.702
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.702
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.702
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.702
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.702
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.702
OB12G26050 Oryza brachyantha OB12G26050 I 0.702
OB04G27010 Oryza brachyantha OB04G27010 I 0.702
OB03G35470 Oryza brachyantha OB03G35470 I 0.702
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.702
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.702
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.702
OBART04G20010 Oryza barthii OBART04G20010 I 0.702
OBART03G27740 Oryza barthii OBART03G27740 I 0.702
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.702
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.702
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.702
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.702
F775_28710 Aegilops tauschii F775_28710 I 0.702
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.702
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.702
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.702
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.702
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.702
OBART12G19190 Oryza barthii OBART12G19190 I 0.702
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.702
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.702
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.702
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.702
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.702
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.702
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.702
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.702
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.702
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.702
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.702
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.702
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.702
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.702
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.702
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.702
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.702
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.702
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.698
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.698
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.698
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.697
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.696
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.696
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.695
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.695
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.691
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.689
CRC Arabidopsis thaliana AT1G69180 D 0.689
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.689
Bra004364 Brassica rapa Bra004364 I 0.689
MDP0000291729 Malus domestica MDP0000291729 I 0.689
Bo6g108630 Brassica oleracea Bo6g108630 I 0.689
MDP0000124879 Malus domestica MDP0000124879 I 0.689
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.689
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.689
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.689
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.685
MDP0000171878 Malus domestica MDP0000171878 I 0.683
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.681
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.680
29927.m000626 Ricinus communis 29927.m000626 I 0.678
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.678
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.678
MDP0000255415 Malus domestica MDP0000255415 I 0.678
mgf010765m Mimulus guttatus mgf010765m I 0.678
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.678
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.678
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.678
TCM_038105 Theobroma cacao TCM_038105 I 0.678
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.678
Pm027559 Prunus mume Pm027559 I 0.678
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.678
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.678
Ca_06681 Cicer arietinum Ca_06681 I 0.678
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.678
Cla012424 Citrullus lanatus Cla012424 I 0.678
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.678
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.678
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.678
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.678
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.678
Bo3g041840 Brassica oleracea Bo3g041840 I 0.678
mgf015972m Mimulus guttatus mgf015972m I 0.678
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.678
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.678
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.678
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.678
Bra000538 Brassica rapa Bra000538 I 0.678
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.678
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.678
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.678
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.678
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.678
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.678
YAB5 Arabidopsis thaliana AT2G26580 D 0.678
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.678
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.678
PK09461.1 Cannabis sativa PK09461.1 I 0.678
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.678
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.678
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.678
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.675
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.674
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.674
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.674
mgf009982m Mimulus guttatus mgf009982m I 0.674
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.674
mgf019496m Mimulus guttatus mgf019496m I 0.674
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.673
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.672
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.668
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.668
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.666
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.660
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.660
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.660
Cla010397 Citrullus lanatus Cla010397 I 0.660
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.660
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.660
Pm030598 Prunus mume Pm030598 I 0.660
Ca_18533 Cicer arietinum Ca_18533 I 0.660
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.660
Ca_12379 Cicer arietinum Ca_12379 I 0.660
30174.m009083 Ricinus communis 30174.m009083 I 0.660
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.660
CRC Vitis vinifera VIT_01s0011g00140 I 0.660
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.660
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.660
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.660
TCM_011484 Theobroma cacao TCM_011484 I 0.660
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.660
PK13838.1 Cannabis sativa PK13838.1 I 0.660
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.660
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.659
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.654
mgf007067m Mimulus guttatus mgf007067m I 0.654
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.654
Cla005767 Citrullus lanatus Cla005767 I 0.652
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.651
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.647
Cla016962 Citrullus lanatus Cla016962 I 0.644
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.644
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.644
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.641
INO Vitis vinifera VIT_01s0127g00330 I 0.641
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.641
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.638
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.638
Ca_21472 Cicer arietinum Ca_21472 I 0.632
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.631
TCM_031868 Theobroma cacao TCM_031868 I 0.631
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.629
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.628
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.628
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.628
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.628
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.628
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.628
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.628
OB03G18700 Oryza brachyantha OB03G18700 I 0.628
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.628
Si037608m.g Setaria italica Si037608m.g I 0.628
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.628
OS03G0215200 Oryza sativa OS03G0215200 I 0.628
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.628
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.628
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.628
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.628
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.628
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.628
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.628
OBART03G08320 Oryza barthii OBART03G08320 I 0.628
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.628
mgf001016m Mimulus guttatus mgf001016m I 0.628
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.628
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.628
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.628
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.628
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.628
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.628
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.628
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.628
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.622
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.621
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.621
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.621
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.614
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.611
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.611
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.611
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.611
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.611
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.611
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.611
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.611
Pm006709 Prunus mume Pm006709 I 0.611
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.611
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.611
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.611
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.603
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.603
MDP0000263713 Malus domestica MDP0000263713 I 0.603
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.603
MDP0000126221 Malus domestica MDP0000126221 I 0.603
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.603
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.598
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.598
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.597
Cla010239 Citrullus lanatus Cla010239 I 0.596
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.589
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.589
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.587
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.585
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.585
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.577
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.577
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.576
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.576
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.576
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.574
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.573
Cla000824 Citrullus lanatus Cla000824 I 0.573
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.573
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.569
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.567
Bo5g039580 Brassica oleracea Bo5g039580 I 0.567
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.567
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.567
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.567
Bo7g056180 Brassica oleracea Bo7g056180 I 0.567
Bra012373 Brassica rapa Bra012373 I 0.567
Bra024599 Brassica rapa Bra024599 I 0.567
INO Arabidopsis thaliana AT1G23420 D 0.567
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.565
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.564
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.560
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.553
Moror_16065 Moniliophthora roreri Moror_16065 I 0.551
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.551
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.545
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.545
OB07G25220 Oryza brachyantha OB07G25220 I 0.545
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.545
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.545
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.541
mgf023167m Mimulus guttatus mgf023167m I 0.540
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.538
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.538
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.538
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.533
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.509
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.496
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
29631.m001046 Ricinus communis 29631.m001046 I 0.486
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.479
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.472
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.472
CND03770 Cryptococcus neoformans CND03770 I 0.467
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.464
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.464
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.456
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.453
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.448
PV09_07652 Verruconis gallopava PV09_07652 I 0.445
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.441
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.440
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.440
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.440
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.440
mgf012563m Mimulus guttatus mgf012563m I 0.439
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.437
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.437
sr16632 Sporisorium reilianum sr16632 I 0.435
GB50764 Apis mellifera GB50764 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
UHOR_08529 Ustilago hordei UHOR_08529 I 0.430
AEPI010254 Anopheles epiroticus AEPI010254 N 0.430
CPIJ003178 Culex quinquefasciatus CPIJ003178 N 0.430
CpipJ_CPIJ003178 Culex pipiens CpipJ_CPIJ003178 N 0.430
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
GE25578 Drosophila yakuba FBgn0242642 I 0.427
GK13574 Drosophila willistoni FBgn0215582 I 0.427
MDOA001488 Musca domestica MDOA001488 I 0.427
GH18160 Drosophila grimshawi FBgn0125628 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.427
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.427
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.427
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.427
scaffold_600397.1 Arabidopsis lyrata scaffold_600397.1 I 0.426
L798_00437 Zootermopsis nevadensis L798_00437 N 0.424
AMIN005634 Anopheles minimus AMIN005634 N 0.424
PHUM393920 Pediculus humanus PHUM393920 N 0.424
AMAM014030 Anopheles maculatus AMAM014030 N 0.424
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.422
OSTLU_15490 Ostreococcus lucimarinus OSTLU_15490 N 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
PEQ_0000291001 Parascaris equorum PEQ_0000291001 I 0.419
PPA12247 Pristionchus pacificus PPA12247 N 0.419
0600010013 Ostreococcus tauri 0600010013 I 0.417
E5Q_04236 Mixia osmundae E5Q_04236 I 0.416
KGM_20190 Danaus plexippus KGM_20190 I 0.416
E5Q_04235 Mixia osmundae E5Q_04235 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.416
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.416
NV13812 Nasonia vitripennis NV13812 I 0.416
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
MCINX012524 Melitaea cinxia MCINX012524 I 0.416
BGLB013489 Biomphalaria glabrata BGLB013489 N 0.415