BRADI4G01300 (Brachypodium distachyon)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 BRADI4G01300 T326735_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.731 0.886
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.706 0.909
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.706 0.909
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.654 0.682
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.654 0.682
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.602 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
BRADI4G01300.1 Sox 131 174
BRADI4G01300.2 Sox 124 167
BRADI4G01300.3 Sox 125 168

Links

Other Sox family TFs
Other Brachypodium distachyon TFs

533 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ALNC14_001150 Albugo laibachii ALNC14_001150 N 0.000
F443_08590 Phytophthora parasitica F443_08590 N 0.000
maker-pag1_scaffold_397-fgenesh-gene-0.4 Pythium aphanidermatum maker-pag1_scaffold_397-fgenesh-gene-0.4 N 0.000
Phyra77254 Phytophthora ramorum Phyra77254 N 0.000
Physo143974 Phytophthora sojae Physo143974 N 0.000
PYU1_G005748 Pythium ultimum PYU1_G005748 N 0.000
snap-pir_contig_55-abinit-gene-0.108 Pythium irregulare snap-pir_contig_55-abinit-gene-0.108 N 0.000