YAB3 (Arabidopsis lyrata)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 fgenesh2_kg.6__3684__AT4G00180.1 T329863_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.741 1.000
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.932
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.705
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.705
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
fgenesh2_kg.6__3684__AT4G00180.1 Sox 151 194

Links

Other Sox family TFs
Other Arabidopsis lyrata TFs

531 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACOM031025 Anopheles coluzzii ACOM031025 I 0.000
AMEM005966 Anopheles merus AMEM005966 I 0.000
A_07498 Schistosoma haematobium A_07498 I 0.000
csin108204 Clonorchis sinensis csin108204 I 0.000
D915_04811 Fasciola hepatica D915_04811 I 0.000
DILT_0000717101 Diphyllobothrium latum DILT_0000717101 I 0.000
ECANG7_01805 Echinococcus canadensis ECANG7_01805 N 0.000
ECPE_0000966901 Echinostoma caproni ECPE_0000966901 I 0.000
EmuJ_000821700 Echinococcus multilocularis EmuJ_000821700 N 0.000
GA11505 Drosophila pseudoobscura FBgn0071556 I 0.000
gcm Drosophila melanogaster FBgn0014179 D 0.000
GD22349 Drosophila simulans FBgn0193756 I 0.000
GE10457 Drosophila yakuba FBgn0228318 I 0.000
GF21907 Drosophila ananassae FBgn0098907 I 0.000
GG24019 Drosophila erecta FBgn0116158 I 0.000
GH11056 Drosophila grimshawi FBgn0118537 I 0.000
GI17574 Drosophila mojavensis FBgn0140318 I 0.000
GJ17916 Drosophila virilis FBgn0205084 I 0.000
GK23810 Drosophila willistoni FBgn0225772 I 0.000
GK23867 Drosophila willistoni FBgn0225829 I 0.000
GL19218 Drosophila persimilis FBgn0156817 I 0.000
GM12386 Drosophila sechellia FBgn0167323 I 0.000
MCOS_0000650801 Mesocestoides corti MCOS_0000650801 I 0.000
PXEA_0000106701 Protopolystoma xenopodis PXEA_0000106701 N 0.000
Sjc_0090760 Schistosoma japonicum Sjc_0090760 I 0.000
Smp_171130 Schistosoma mansoni Smp_171130 I 0.000
SMTD_0000548601 Schistosoma mattheei SMTD_0000548601 I 0.000
SSLN_0001903801 Schistocephalus solidus SSLN_0001903801 I 0.000
T265_00115 Opisthorchis viverrini T265_00115 I 0.000
TASK_0000418001 Taenia asiatica TASK_0000418001 N 0.000
TRE_0001360101 Trichobilharzia regenti TRE_0001360101 I 0.000