GRMZM2G102218 (Zea mays)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GRMZM2G102218 T330329_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.673 0.800
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.673 0.800
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.657 0.689
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.627 0.667
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.627 0.667
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.556 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
GRMZM2G102218_P01 Sox 209 253

Links

Other Sox family TFs
Other Zea mays TFs

501 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
27964.m000352 Ricinus communis 27964.m000352 I 0.000
27964.m000356 Ricinus communis 27964.m000356 I 0.000
29742.m001404 Ricinus communis 29742.m001404 I 0.000
29827.m002528 Ricinus communis 29827.m002528 I 0.000
29883.m002023 Ricinus communis 29883.m002023 I 0.000
30068.m002581 Ricinus communis 30068.m002581 I 0.000
AIB Arabidopsis thaliana AT2G46510 I 0.000
Al_scaffold_0006_3930 Arabidopsis lyrata Al_scaffold_0006_3930 I 0.000
AMTR_s00002p00225810 Amborella trichopoda AMTR_s00002p00225810 I 0.000
AMTR_s00021p00226670 Amborella trichopoda AMTR_s00021p00226670 I 0.000
AMTR_s00099p00127980 Amborella trichopoda AMTR_s00099p00127980 I 0.000
AMTR_s00121p00026620 Amborella trichopoda AMTR_s00121p00026620 I 0.000
Aquca_014_00031 Aquilegia coerulea Aquca_014_00031 I 0.000
Aquca_026_00421 Aquilegia coerulea Aquca_026_00421 I 0.000
Aquca_037_00261 Aquilegia coerulea Aquca_037_00261 I 0.000
ATAIB Arabidopsis lyrata fgenesh2_kg.4__2868__AT2G46510.1 I 0.000
ATMYC2 Arabidopsis lyrata scaffold_103634.1 I 0.000
ATNIG1 Arabidopsis lyrata Al_scaffold_0008_132 I 0.000
BGIOSGA015604 Oryza indica BGIOSGA015604 I 0.000
BGIOSGA026551 Oryza indica BGIOSGA026551 I 0.000
BGIOSGA033493 Oryza indica BGIOSGA033493 I 0.000
BHLH13 Arabidopsis thaliana AT1G01260 D 0.000
BHLH14 Arabidopsis thaliana AT4G00870 D 0.000
BHLH28 Arabidopsis thaliana AT5G46830 D 0.000
Bo01130s010 Brassica oleracea Bo01130s010 I 0.000
Bo1g017990 Brassica oleracea Bo1g017990 I 0.000
Bo4g008180 Brassica oleracea Bo4g008180 I 0.000
Bo4g197150 Brassica oleracea Bo4g197150 I 0.000
Bo5g002590 Brassica oleracea Bo5g002590 I 0.000
Bo5g086990 Brassica oleracea Bo5g086990 I 0.000
Bo7g075710 Brassica oleracea Bo7g075710 I 0.000
Bo7g075820 Brassica oleracea Bo7g075820 I 0.000
Bo8g028850 Brassica oleracea Bo8g028850 I 0.000
Bo9g065530 Brassica oleracea Bo9g065530 I 0.000
Bo9g066680 Brassica oleracea Bo9g066680 I 0.000
Bostr.25993s0115 Boechera stricta Bostr.25993s0115 I 0.000
Bostr.28243s0053 Boechera stricta Bostr.28243s0053 I 0.000
Bostr.28243s0060 Boechera stricta Bostr.28243s0060 I 0.000
Bostr.30275s0255 Boechera stricta Bostr.30275s0255 I 0.000
Bostr.3359s0090 Boechera stricta Bostr.3359s0090 I 0.000
Bostr.5325s0049 Boechera stricta Bostr.5325s0049 I 0.000
Bostr.7365s0026 Boechera stricta Bostr.7365s0026 I 0.000
Bra004532 Brassica rapa Bra004532 I 0.000
Bra010178 Brassica rapa Bra010178 I 0.000
Bra013263 Brassica rapa Bra013263 I 0.000
Bra017520 Brassica rapa Bra017520 I 0.000
Bra017523 Brassica rapa Bra017523 I 0.000
Bra017527 Brassica rapa Bra017527 I 0.000
Bra024992 Brassica rapa Bra024992 I 0.000
Bra024993 Brassica rapa Bra024993 I 0.000
Bra024998 Brassica rapa Bra024998 I 0.000
Bra033273 Brassica rapa Bra033273 I 0.000
Bra039279 Brassica rapa Bra039279 I 0.000
BRADI2G08080 Brachypodium distachyon BRADI2G08080 I 0.000
BRADI3G34200 Brachypodium distachyon BRADI3G34200 I 0.000
Cagra.0050s0048 Capsella grandiflora Cagra.0050s0048 I 0.000
Cagra.0751s0023 Capsella grandiflora Cagra.0751s0023 I 0.000
Cagra.1968s0070 Capsella grandiflora Cagra.1968s0070 I 0.000
Cagra.3356s0080 Capsella grandiflora Cagra.3356s0080 I 0.000
Cagra.4923s0009 Capsella grandiflora Cagra.4923s0009 I 0.000
Cagra.7865s0024 Capsella grandiflora Cagra.7865s0024 I 0.000
Carubv10001082m.g Capsella rubella Carubv10001082m.g I 0.000
Carubv10004392m.g Capsella rubella Carubv10004392m.g I 0.000
Carubv10008586m.g Capsella rubella Carubv10008586m.g I 0.000
Carubv10008640m.g Capsella rubella Carubv10008640m.g I 0.000
Carubv10025360m.g Capsella rubella Carubv10025360m.g I 0.000
Carubv10028441m.g Capsella rubella Carubv10028441m.g I 0.000
cassava29800.valid.m1 Manihot esculenta cassava29800.valid.m1 I 0.000
cassava32651.m1 Manihot esculenta cassava32651.m1 I 0.000
cassava32975.m1 Manihot esculenta cassava32975.m1 I 0.000
cassava36709.valid.m1 Manihot esculenta cassava36709.valid.m1 I 0.000
cassava39612.m1 Manihot esculenta cassava39612.m1 I 0.000
cassava40529.m1 Manihot esculenta cassava40529.m1 I 0.000
cassava41468.m1 Manihot esculenta cassava41468.m1 I 0.000
cassava45188.m1 Manihot esculenta cassava45188.m1 I 0.000
cassava45205.m1 Manihot esculenta cassava45205.m1 I 0.000
cassava45233.m1 Manihot esculenta cassava45233.m1 I 0.000
cassava45234.m1 Manihot esculenta cassava45234.m1 I 0.000
cassava46510.m1 Manihot esculenta cassava46510.m1 I 0.000
cassava8764.m1 Manihot esculenta cassava8764.m1 I 0.000
Ca_01324 Cicer arietinum Ca_01324 I 0.000
Ca_09378 Cicer arietinum Ca_09378 I 0.000
Ca_11514 Cicer arietinum Ca_11514 I 0.000
Ca_12209 Cicer arietinum Ca_12209 I 0.000
Ca_12352 Cicer arietinum Ca_12352 I 0.000
Ca_17603 Cicer arietinum Ca_17603 I 0.000
Ca_17639 Cicer arietinum Ca_17639 I 0.000
chr1.CM0375.280.nd Lotus japonicus chr1.CM0375.280.nd I 0.000
chr2.CM0177.830.nc Lotus japonicus chr2.CM0177.830.nc I 0.000
Ciclev10011214m.g Citrus clementina Ciclev10011214m.g I 0.000
Ciclev10019339m.g Citrus clementina Ciclev10019339m.g I 0.000
Ciclev10019730m.g Citrus clementina Ciclev10019730m.g N 0.000
Ciclev10019749m.g Citrus clementina Ciclev10019749m.g I 0.000
Ciclev10019816m.g Citrus clementina Ciclev10019816m.g I 0.000
Cla006102 Citrullus lanatus Cla006102 I 0.000
Cla006801 Citrullus lanatus Cla006801 I 0.000
Cla006802 Citrullus lanatus Cla006802 I 0.000
Cla007989 Citrullus lanatus Cla007989 I 0.000
Cla008954 Citrullus lanatus Cla008954 I 0.000
Cla009039 Citrullus lanatus Cla009039 I 0.000
Cla016454 Citrullus lanatus Cla016454 I 0.000
Cla021464 Citrullus lanatus Cla021464 I 0.000
Cucsa.053540 Cucumis sativus Cucsa.053540 I 0.000
Cucsa.120830 Cucumis sativus Cucsa.120830 I 0.000
Cucsa.178140 Cucumis sativus Cucsa.178140 I 0.000
Cucsa.259300 Cucumis sativus Cucsa.259300 I 0.000
Cucsa.313090 Cucumis sativus Cucsa.313090 I 0.000
Cucsa.321840 Cucumis sativus Cucsa.321840 I 0.000
Cucsa.322560 Cucumis sativus Cucsa.322560 I 0.000
estExt_fgenesh1_pg.C_50104 Physcomitrella patens estExt_fgenesh1_pg.C_50104 I 0.000
estExt_fgenesh1_pg.C_740025 Physcomitrella patens estExt_fgenesh1_pg.C_740025 I 0.000
estExt_fgenesh1_pg.C_740028 Physcomitrella patens estExt_fgenesh1_pg.C_740028 I 0.000
Eucgr.B00713 Eucalyptus grandis Eucgr.B00713 I 0.000
Eucgr.E00019 Eucalyptus grandis Eucgr.E00019 I 0.000
Eucgr.E00047 Eucalyptus grandis Eucgr.E00047 I 0.000
Eucgr.E00277 Eucalyptus grandis Eucgr.E00277 I 0.000
Eucgr.E01042 Eucalyptus grandis Eucgr.E01042 I 0.000
Eucgr.E01045 Eucalyptus grandis Eucgr.E01045 I 0.000
Eucgr.E01049 Eucalyptus grandis Eucgr.E01049 I 0.000
Eucgr.H02385 Eucalyptus grandis Eucgr.H02385 I 0.000
Eucgr.K03293 Eucalyptus grandis Eucgr.K03293 I 0.000
evm.TU.contig_45808 Carica papaya evm.TU.contig_45808 I 0.000
evm.TU.supercontig_141.19 Carica papaya evm.TU.supercontig_141.19 I 0.000
evm.TU.supercontig_1892.1 Carica papaya evm.TU.supercontig_1892.1 I 0.000
evm.TU.supercontig_71.72 Carica papaya evm.TU.supercontig_71.72 I 0.000
e_gw1.11.52.1 Physcomitrella patens e_gw1.11.52.1 I 0.000
F775_26406 Aegilops tauschii F775_26406 I 0.000
fgenesh2_kg.1__101__AT1G01260.1 Arabidopsis lyrata fgenesh2_kg.1__101__AT1G01260.1 I 0.000
fgenesh2_kg.7__2520__AT4G17880.1 Arabidopsis lyrata fgenesh2_kg.7__2520__AT4G17880.1 I 0.000
gene01894-v1.0-hybrid Fragaria vesca gene01894-v1.0-hybrid I 0.000
gene08231-v1.0-hybrid Fragaria vesca gene08231-v1.0-hybrid I 0.000
gene10501-v1.0-hybrid Fragaria vesca gene10501-v1.0-hybrid I 0.000
gene13705-v1.0-hybrid Fragaria vesca gene13705-v1.0-hybrid I 0.000
gene18651-v1.0-hybrid Fragaria vesca gene18651-v1.0-hybrid I 0.000
gene19143-v1.0-hybrid Fragaria vesca gene19143-v1.0-hybrid I 0.000
GLYMA01G02251 Glycine max GLYMA01G02251 I 0.000
GLYMA01G12740 Glycine max GLYMA01G12740 I 0.000
GLYMA02G09670 Glycine max GLYMA02G09670 I 0.000
GLYMA03G38391 Glycine max GLYMA03G38391 I 0.000
GLYMA03G41901 Glycine max GLYMA03G41901 I 0.000
GLYMA07G05740 Glycine max GLYMA07G05740 I 0.000
GLYMA07G06090 Glycine max GLYMA07G06090 I 0.000
GLYMA08G36720 Glycine max GLYMA08G36720 I 0.000
GLYMA09G33730 Glycine max GLYMA09G33730 I 0.000
GLYMA10G03950 Glycine max GLYMA10G03950 I 0.000
GLYMA13G18131 Glycine max GLYMA13G18131 I 0.000
GLYMA16G02320 Glycine max GLYMA16G02320 I 0.000
GLYMA16G02690 Glycine max GLYMA16G02690 I 0.000
GLYMA19G40980 Glycine max GLYMA19G40980 I 0.000
GLYMA19G44570 Glycine max GLYMA19G44570 I 0.000
Gorai.001G151700 Gossypium raimondii Gorai.001G151700 I 0.000
Gorai.003G182100 Gossypium raimondii Gorai.003G182100 I 0.000
Gorai.004G129600 Gossypium raimondii Gorai.004G129600 I 0.000
Gorai.004G149500 Gossypium raimondii Gorai.004G149500 I 0.000
Gorai.004G184800 Gossypium raimondii Gorai.004G184800 I 0.000
Gorai.006G216700 Gossypium raimondii Gorai.006G216700 I 0.000
Gorai.007G109300 Gossypium raimondii Gorai.007G109300 I 0.000
Gorai.007G111800 Gossypium raimondii Gorai.007G111800 I 0.000
Gorai.007G143800 Gossypium raimondii Gorai.007G143800 I 0.000
Gorai.008G128800 Gossypium raimondii Gorai.008G128800 I 0.000
Gorai.008G226300 Gossypium raimondii Gorai.008G226300 I 0.000
Gorai.008G259000 Gossypium raimondii Gorai.008G259000 N 0.000
GRMZM2G001930 Zea mays GRMZM2G001930 I 0.000
GRMZM2G049229 Zea mays GRMZM2G049229 I 0.000
GRMZM2G076636 Zea mays GRMZM2G076636 I 0.000
GRMZM2G148723 Zea mays GRMZM2G148723 I 0.000
GSMUA_Achr10G07470_001 Musa acuminata GSMUA_Achr10G07470_001 I 0.000
GSMUA_Achr10G22310_001 Musa acuminata GSMUA_Achr10G22310_001 I 0.000
GSMUA_Achr11G17840_001 Musa acuminata GSMUA_Achr11G17840_001 I 0.000
GSMUA_Achr1G08130_001 Musa acuminata GSMUA_Achr1G08130_001 N 0.000
GSMUA_Achr1G14370_001 Musa acuminata GSMUA_Achr1G14370_001 I 0.000
GSMUA_Achr1G18910_001 Musa acuminata GSMUA_Achr1G18910_001 I 0.000
GSMUA_Achr1G28110_001 Musa acuminata GSMUA_Achr1G28110_001 I 0.000
GSMUA_Achr2G18140_001 Musa acuminata GSMUA_Achr2G18140_001 I 0.000
GSMUA_Achr3G00370_001 Musa acuminata GSMUA_Achr3G00370_001 I 0.000
GSMUA_Achr4G16980_001 Musa acuminata GSMUA_Achr4G16980_001 I 0.000
GSMUA_Achr7G04720_001 Musa acuminata GSMUA_Achr7G04720_001 I 0.000
GSMUA_Achr7G14640_001 Musa acuminata GSMUA_Achr7G14640_001 I 0.000
GSMUA_Achr8G05350_001 Musa acuminata GSMUA_Achr8G05350_001 I 0.000
GSMUA_Achr8G14720_001 Musa acuminata GSMUA_Achr8G14720_001 I 0.000
GSMUA_Achr8G26280_001 Musa acuminata GSMUA_Achr8G26280_001 I 0.000
GSMUA_AchrUn_randomG01830_001 Musa acuminata GSMUA_AchrUn_randomG01830_001 I 0.000
GSMUA_AchrUn_randomG02900_001 Musa acuminata GSMUA_AchrUn_randomG02900_001 I 0.000
LjSGA_047295.1 Lotus japonicus LjSGA_047295.1 I 0.000
LPERR01G07720 Leersia perrieri LPERR01G07720 I 0.000
LPERR03G22350 Leersia perrieri LPERR03G22350 I 0.000
LPERR10G15300 Leersia perrieri LPERR10G15300 I 0.000
Lus10000037.g Linum usitatissimum Lus10000037.g I 0.000
Lus10000484.g Linum usitatissimum Lus10000484.g I 0.000
Lus10004574.g Linum usitatissimum Lus10004574.g I 0.000
Lus10004575.g Linum usitatissimum Lus10004575.g I 0.000
Lus10005966.g Linum usitatissimum Lus10005966.g I 0.000
Lus10005999.g Linum usitatissimum Lus10005999.g I 0.000
Lus10018787.g Linum usitatissimum Lus10018787.g I 0.000
Lus10024871.g Linum usitatissimum Lus10024871.g I 0.000
Lus10030243.g Linum usitatissimum Lus10030243.g I 0.000
Lus10030970.g Linum usitatissimum Lus10030970.g I 0.000
MDP0000029168 Malus domestica MDP0000029168 I 0.000
MDP0000136498 Malus domestica MDP0000136498 I 0.000
MDP0000137325 Malus domestica MDP0000137325 I 0.000
MDP0000160600 Malus domestica MDP0000160600 I 0.000
MDP0000183948 Malus domestica MDP0000183948 I 0.000
MDP0000224302 Malus domestica MDP0000224302 I 0.000
MDP0000226497 Malus domestica MDP0000226497 I 0.000
MDP0000229725 Malus domestica MDP0000229725 I 0.000
MDP0000242554 Malus domestica MDP0000242554 I 0.000
MDP0000279087 Malus domestica MDP0000279087 I 0.000
MDP0000386580 Malus domestica MDP0000386580 I 0.000
MDP0000401086 Malus domestica MDP0000401086 I 0.000
MDP0000406270 Malus domestica MDP0000406270 I 0.000
MDP0000442310 Malus domestica MDP0000442310 I 0.000
MDP0000603546 Malus domestica MDP0000603546 I 0.000
MDP0000710285 Malus domestica MDP0000710285 I 0.000
MDP0000729514 Malus domestica MDP0000729514 I 0.000
MDP0000859492 Malus domestica MDP0000859492 I 0.000
MDP0000900024 Malus domestica MDP0000900024 I 0.000
mgf001638m Mimulus guttatus mgf001638m I 0.000
mgf001993m Mimulus guttatus mgf001993m I 0.000
mgf002775m Mimulus guttatus mgf002775m I 0.000
mgf011621m Mimulus guttatus mgf011621m I 0.000
mgf018623m Mimulus guttatus mgf018623m I 0.000
mgf022967m Mimulus guttatus mgf022967m I 0.000
mgf023325m Mimulus guttatus mgf023325m I 0.000
MLOC_33189 Hordeum vulgare MLOC_33189 I 0.000
MLOC_69470 Hordeum vulgare MLOC_69470 I 0.000
MLOC_71611 Hordeum vulgare MLOC_71611 I 0.000
MTR_0246s0020 Medicago truncatula MTR_0246s0020 I 0.000
MTR_4g097950 Medicago truncatula MTR_4g097950 I 0.000
MTR_5g030430 Medicago truncatula MTR_5g030430 I 0.000
MTR_7g096350 Medicago truncatula MTR_7g096350 I 0.000
MTR_7g117670 Medicago truncatula MTR_7g117670 I 0.000
MTR_8g024770 Medicago truncatula MTR_8g024770 I 0.000
MTR_8g024790 Medicago truncatula MTR_8g024790 I 0.000
MTR_8g027495 Medicago truncatula MTR_8g027495 I 0.000
MTR_8g067280 Medicago truncatula MTR_8g067280 I 0.000
MYC2 Oryza sativa OS10G0575000 I 0.000
MYC2 Arabidopsis thaliana AT1G32640 D 0.000
MYC3 Arabidopsis thaliana AT5G46760 D 0.000
MYC4 Arabidopsis thaliana AT4G17880 D 0.000
OB01G18800 Oryza brachyantha OB01G18800 I 0.000
OBART01G08590 Oryza barthii OBART01G08590 I 0.000
OGLUM01G09830 Oryza glumaepatula OGLUM01G09830 I 0.000
OGLUM08G23650 Oryza glumaepatula OGLUM08G23650 I 0.000
OGLUM10G19510 Oryza glumaepatula OGLUM10G19510 I 0.000
OLONG_005869 Oryza longistaminata OLONG_005869 I 0.000
OLONG_011820 Oryza longistaminata OLONG_011820 I 0.000
OMERI01G08610 Oryza meridionalis OMERI01G08610 I 0.000
OMERI08G17270 Oryza meridionalis OMERI08G17270 I 0.000
ONIVA01G11170 Oryza nivara ONIVA01G11170 I 0.000
ONIVA08G25370 Oryza nivara ONIVA08G25370 I 0.000
ONIVA10G22030 Oryza nivara ONIVA10G22030 I 0.000
OPUNC01G08460 Oryza punctata OPUNC01G08460 I 0.000
OPUNC10G17860 Oryza punctata OPUNC10G17860 I 0.000
orange1.1g005651m.g Citrus sinensis orange1.1g005651m.g I 0.000
orange1.1g010053m.g Citrus sinensis orange1.1g010053m.g N 0.000
orange1.1g010728m.g Citrus sinensis orange1.1g010728m.g I 0.000
orange1.1g046178m.g Citrus sinensis orange1.1g046178m.g I 0.000
orange1.1g048817m.g Citrus sinensis orange1.1g048817m.g I 0.000
ORGLA01G0077100 Oryza glaberrima ORGLA01G0077100 I 0.000
ORGLA08G0221300 Oryza glaberrima ORGLA08G0221300 I 0.000
ORGLA10G0146100 Oryza glaberrima ORGLA10G0146100 I 0.000
ORUFI01G09400 Oryza rufipogon ORUFI01G09400 I 0.000
ORUFI08G24840 Oryza rufipogon ORUFI08G24840 I 0.000
ORUFI10G20700 Oryza rufipogon ORUFI10G20700 I 0.000
OS01G0235700 Oryza sativa OS01G0235700 D 0.000
OS08G0543700 Oryza sativa OS08G0543700 I 0.000
Pavir.Ca00449 Panicum virgatum Pavir.Ca00449 I 0.000
Pavir.Cb01851 Panicum virgatum Pavir.Cb01851 I 0.000
Pavir.Ea00030 Panicum virgatum Pavir.Ea00030 I 0.000
Pavir.Eb00041 Panicum virgatum Pavir.Eb00041 I 0.000
Pavir.Ia03512 Panicum virgatum Pavir.Ia03512 I 0.000
Pavir.J28686 Panicum virgatum Pavir.J28686 I 0.000
Pavir.J38781 Panicum virgatum Pavir.J38781 I 0.000
PDK_20s1668561g001 Phoenix dactylifera PDK_20s1668561g001 I 0.000
PGSC0003DMG400000232 Solanum tuberosum PGSC0003DMG400000232 I 0.000
PGSC0003DMG400001161 Solanum tuberosum PGSC0003DMG400001161 I 0.000
PGSC0003DMG400005525 Solanum tuberosum PGSC0003DMG400005525 I 0.000
PGSC0003DMG400005528 Solanum tuberosum PGSC0003DMG400005528 I 0.000
PGSC0003DMG400005860 Solanum tuberosum PGSC0003DMG400005860 I 0.000
PGSC0003DMG400012237 Solanum tuberosum PGSC0003DMG400012237 I 0.000
PGSC0003DMG400017535 Solanum tuberosum PGSC0003DMG400017535 I 0.000
PGSC0003DMG400018332 Solanum tuberosum PGSC0003DMG400018332 I 0.000
PGSC0003DMG400020066 Solanum tuberosum PGSC0003DMG400020066 I 0.000
PGSC0003DMG401010822 Solanum tuberosum PGSC0003DMG401010822 I 0.000
PK00939.1 Cannabis sativa PK00939.1 I 0.000
PK18474.1 Cannabis sativa PK18474.1 D 0.000
PK23618.1 Cannabis sativa PK23618.1 I 0.000
PK29179.1 Cannabis sativa PK29179.1 I 0.000
Pm018355 Prunus mume Pm018355 I 0.000
Pm020642 Prunus mume Pm020642 I 0.000
Pm023237 Prunus mume Pm023237 I 0.000
Pm023735 Prunus mume Pm023735 I 0.000
Pm023738 Prunus mume Pm023738 I 0.000
Pm028604 Prunus mume Pm028604 I 0.000
Pm028605 Prunus mume Pm028605 I 0.000
Pm028606 Prunus mume Pm028606 I 0.000
Pm028607 Prunus mume Pm028607 I 0.000
Pm029399 Prunus mume Pm029399 I 0.000
POPTR_0001s02450 Populus trichocarpa POPTR_0001s02450 I 0.000
POPTR_0001s11400 Populus trichocarpa POPTR_0001s11400 I 0.000
POPTR_0002s04310 Populus trichocarpa POPTR_0002s04310 I 0.000
POPTR_0002s17310 Populus trichocarpa POPTR_0002s17310 I 0.000
POPTR_0002s17750 Populus trichocarpa POPTR_0002s17750 I 0.000
POPTR_0003s09090 Populus trichocarpa POPTR_0003s09090 I 0.000
POPTR_0003s14710 Populus trichocarpa POPTR_0003s14710 I 0.000
POPTR_0005s24240 Populus trichocarpa POPTR_0005s24240 I 0.000
POPTR_0014s09520 Populus trichocarpa POPTR_0014s09520 I 0.000
POPTR_0014s09950 Populus trichocarpa POPTR_0014s09950 I 0.000
PRUPE_ppa002404mg Prunus persica PRUPE_ppa002404mg I 0.000
PRUPE_ppa002985mg Prunus persica PRUPE_ppa002985mg I 0.000
PRUPE_ppa004680mg Prunus persica PRUPE_ppa004680mg I 0.000
PRUPE_ppa005343mg Prunus persica PRUPE_ppa005343mg I 0.000
PRUPE_ppa008004mg Prunus persica PRUPE_ppa008004mg I 0.000
PRUPE_ppa016220mg Prunus persica PRUPE_ppa016220mg I 0.000
PRUPE_ppa022165mg Prunus persica PRUPE_ppa022165mg I 0.000
PRUPE_ppa022201mg Prunus persica PRUPE_ppa022201mg I 0.000
PRUPE_ppa025417mg Prunus persica PRUPE_ppa025417mg I 0.000
PRUPE_ppa027182mg Prunus persica PRUPE_ppa027182mg I 0.000
SapurV1A.0003s0670 Salix purpurea SapurV1A.0003s0670 I 0.000
SapurV1A.0003s1040 Salix purpurea SapurV1A.0003s1040 I 0.000
SapurV1A.0006s1070 Salix purpurea SapurV1A.0006s1070 I 0.000
SapurV1A.0013s0270 Salix purpurea SapurV1A.0013s0270 I 0.000
SapurV1A.0013s0280 Salix purpurea SapurV1A.0013s0280 I 0.000
SapurV1A.0059s0390 Salix purpurea SapurV1A.0059s0390 I 0.000
SapurV1A.0094s0280 Salix purpurea SapurV1A.0094s0280 I 0.000
SapurV1A.0151s0080 Salix purpurea SapurV1A.0151s0080 I 0.000
SapurV1A.0162s0110 Salix purpurea SapurV1A.0162s0110 I 0.000
SapurV1A.0378s0120 Salix purpurea SapurV1A.0378s0120 I 0.000
SapurV1A.0741s0050 Salix purpurea SapurV1A.0741s0050 I 0.000
Sb01g028230 Sorghum bicolor Sb01g028230 I 0.000
Sb03g000570 Sorghum bicolor Sb03g000570 I 0.000
Sb09g008120 Sorghum bicolor Sb09g008120 I 0.000
scaffold_800152.1 Arabidopsis lyrata scaffold_800152.1 I 0.000
Si003963m.g Setaria italica Si003963m.g I 0.000
Si021549m.g Setaria italica Si021549m.g I 0.000
Si039973m.g Setaria italica Si039973m.g I 0.000
Solyc01g096050.2 Solanum lycopersicum Solyc01g096050.2 I 0.000
Solyc01g096370.2 Solanum lycopersicum Solyc01g096370.2 I 0.000
Solyc06g083980.1 Solanum lycopersicum Solyc06g083980.1 I 0.000
Solyc08g008600.2 Solanum lycopersicum Solyc08g008600.2 I 0.000
Solyc08g076930.1 Solanum lycopersicum Solyc08g076930.1 I 0.000
Solyc08g083170.1 Solanum lycopersicum Solyc08g083170.1 I 0.000
Solyc10g009270.2 Solanum lycopersicum Solyc10g009270.2 I 0.000
Solyc10g009290.1 Solanum lycopersicum Solyc10g009290.1 I 0.000
TCM_005131 Theobroma cacao TCM_005131 I 0.000
TCM_015640 Theobroma cacao TCM_015640 N 0.000
TCM_015714 Theobroma cacao TCM_015714 I 0.000
Thhalv10000808m.g Eutrema salsugineum Thhalv10000808m.g I 0.000
Thhalv10000853m.g Eutrema salsugineum Thhalv10000853m.g I 0.000
Thhalv10001374m.g Eutrema salsugineum Thhalv10001374m.g I 0.000
Thhalv10007075m.g Eutrema salsugineum Thhalv10007075m.g I 0.000
Thhalv10007139m.g Eutrema salsugineum Thhalv10007139m.g I 0.000
Thhalv10024688m.g Eutrema salsugineum Thhalv10024688m.g I 0.000
Traes_2BL_F38E03233 Triticum aestivum Traes_2BL_F38E03233 N 0.000
Traes_2BL_F38E032331 Triticum aestivum Traes_2BL_F38E032331 N 0.000
Traes_3AS_337600412 Triticum aestivum Traes_3AS_337600412 I 0.000
Traes_3B_5DC4D39A6 Triticum aestivum Traes_3B_5DC4D39A6 I 0.000
Traes_3DS_247FA5037 Triticum aestivum Traes_3DS_247FA5037 I 0.000
Traes_4AS_D95D10893 Triticum aestivum Traes_4AS_D95D10893 I 0.000
Traes_4BL_FD0D3B74A Triticum aestivum Traes_4BL_FD0D3B74A I 0.000
Traes_4DL_DA70DBAFC Triticum aestivum Traes_4DL_DA70DBAFC I 0.000
Traes_5BL_D45BBFEBC Triticum aestivum Traes_5BL_D45BBFEBC N 0.000
TRIUR3_13265 Triticum urartu TRIUR3_13265 I 0.000
TRIUR3_29141 Triticum urartu TRIUR3_29141 N 0.000
VIT_02s0012g01320 Vitis vinifera VIT_02s0012g01320 I 0.000
VIT_02s0025g02610 Vitis vinifera VIT_02s0025g02610 I 0.000
VIT_07s0141g01060 Vitis vinifera VIT_07s0141g01060 I 0.000
VIT_15s0046g00320 Vitis vinifera VIT_15s0046g00320 I 0.000
VIT_15s0048g02820 Vitis vinifera VIT_15s0048g02820 I 0.000