GRMZM2G106204 (Zea mays)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GRMZM2G106204 T330330_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.737 0.867
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.822
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.822
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.711
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.711
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.689
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
GRMZM2G106204_P01 Sox 111 155
GRMZM2G106204_P02 Sox 111 155

Links

Other Sox family TFs
Other Zea mays TFs

533 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Hes1 Mus musculus ENSMUSG00000022528 D 0.000
HES1 Homo sapiens ENSG00000114315 D 0.000
ENSORLG00000004584 Oryzias latipes ENSORLG00000004584 I 0.000
HES1 Pteropus vampyrus ENSPVAG00000015487 I 0.000
Hes1 Rattus norvegicus ENSRNOG00000001720 I 0.000
ENSSSCG00000024430 Sus scrofa ENSSSCG00000024430 I 0.000
ENSSSCG00000026362 Sus scrofa ENSSSCG00000026362 I 0.000
ENSSTOG00000026531 Ictidomys tridecemlineatus ENSSTOG00000026531 I 0.000
HES4 Taeniopygia guttata ENSTGUG00000009134 I 0.000
ENSTNIG00000007837 Tetraodon nigroviridis ENSTNIG00000007837 I 0.000
her9 Tetraodon nigroviridis ENSTNIG00000015161 I 0.000
her6 Tetraodon nigroviridis ENSTNIG00000015567 I 0.000
ENSTRUG00000001493 Takifugu rubripes ENSTRUG00000001493 I 0.000
her9 Takifugu rubripes ENSTRUG00000009985 I 0.000
HES4 Pteropus vampyrus ENSPVAG00000010837 I 0.000
ENSPTRG00000039445 Pan troglodytes ENSPTRG00000039445 I 0.000
hes4 Oryzias latipes ENSORLG00000005453 I 0.000
hes1 Oryzias latipes ENSORLG00000007556 I 0.000
ENSPANG00000018250 Papio anubis ENSPANG00000018250 I 0.000
ENSPANG00000024455 Papio anubis ENSPANG00000024455 I 0.000
HES2 Procavia capensis ENSPCAG00000007135 I 0.000
ENSPFOG00000016659 Poecilia formosa ENSPFOG00000016659 I 0.000
ENSPFOG00000019084 Poecilia formosa ENSPFOG00000019084 I 0.000
ENSPFOG00000022586 Poecilia formosa ENSPFOG00000022586 I 0.000
ENSPPYG00000014419 Pongo abelii ENSPPYG00000014419 I 0.000
ENSPSIG00000013040 Pelodiscus sinensis ENSPSIG00000013040 I 0.000
HES1 Pan troglodytes ENSPTRG00000015753 I 0.000
ENSPTRG00000023647 Pan troglodytes ENSPTRG00000023647 I 0.000
her6 Takifugu rubripes ENSTRUG00000017395 I 0.000
HES1 Tursiops truncatus ENSTTRG00000001687 I 0.000
estExt_fgenesh2_pg.C_3520029 Branchiostoma floridae estExt_fgenesh2_pg.C_3520029 I 0.000
estExt_fgenesh2_pg.C_3520032 Branchiostoma floridae estExt_fgenesh2_pg.C_3520032 I 0.000
estExt_fgenesh2_pg.C_3670032 Branchiostoma floridae estExt_fgenesh2_pg.C_3670032 I 0.000
estExt_GenewiseH_1.C_2610051 Branchiostoma floridae estExt_GenewiseH_1.C_2610051 I 0.000
estExt_GenewiseH_1.C_960240 Branchiostoma floridae estExt_GenewiseH_1.C_960240 I 0.000
AAY96799 Xenopus tropicalis AAY96799 I 0.000
AAZ04408 Xenopus tropicalis AAZ04408 I 0.000
hes4 Xenopus tropicalis XB-GENE-487830 I 0.000
hes1 Xenopus tropicalis XB-GENE-487995 I 0.000
hes4.S Xenopus laevis XB-GENE-6256031 I 0.000
hes1.S Xenopus laevis XB-GENE-6256448 I 0.000
hes4.L Xenopus laevis XB-GENE-865740 I 0.000
estExt_fgenesh2_pg.C_2610044 Branchiostoma floridae estExt_fgenesh2_pg.C_2610044 I 0.000
estExt_fgenesh2_pg.C_2610041 Branchiostoma floridae estExt_fgenesh2_pg.C_2610041 I 0.000
ENSXMAG00000003794 Xiphophorus maculatus ENSXMAG00000003794 I 0.000
ENSXMAG00000004442 Xiphophorus maculatus ENSXMAG00000004442 I 0.000
Alligator_sinensis_CCG015374.1 Alligator sinensis Alligator_sinensis_CCG015374.1 I 0.000
ENSBTAP00000000742-D1 Bos grunniens ENSBTAP00000000742-D1 I 0.000
ENSBTAP00000028261-D1 Bos grunniens ENSBTAP00000028261-D1 I 0.000
ENSP00000232424 Macaca fascicularis ENSP00000232424 I 0.000
Ogr04559 Ophisaurus gracilis Ogr04559 I 0.000
Ogr11517 Ophisaurus gracilis Ogr11517 I 0.000
Pvit_06331 Pogona vitticeps Pvit_06331 I 0.000
Pvit_14102 Pogona vitticeps Pvit_14102 I 0.000
estExt_fgenesh2_kg.C_140002 Branchiostoma floridae estExt_fgenesh2_kg.C_140002 I 0.000
estExt_fgenesh2_kg.C_9080002 Branchiostoma floridae estExt_fgenesh2_kg.C_9080002 I 0.000
hes1.L Xenopus laevis XB-GENE-865756 I 0.000
HES1 Anolis carolinensis ENSACAG00000001611 I 0.000
HES4 Dasypus novemcinctus ENSDNOG00000024495 I 0.000
HES1 Dasypus novemcinctus ENSDNOG00000039639 I 0.000
ENSDORG00000014783 Dipodomys ordii ENSDORG00000014783 I 0.000
HES1 Equus caballus ENSECAG00000026945 I 0.000
ENSFALG00000007228 Ficedula albicollis ENSFALG00000007228 I 0.000
HES4 Homo sapiens ENSG00000188290 I 0.000
her9 Gasterosteus aculeatus ENSGACG00000007334 I 0.000
her6 Gasterosteus aculeatus ENSGACG00000009264 I 0.000
ENSGACG00000015969 Gasterosteus aculeatus ENSGACG00000015969 I 0.000
hairy1 Gallus gallus ENSGALG00000002055 I 0.000
HES1 Gorilla gorilla ENSGGOG00000008521 I 0.000
her9 Danio rerio ENSDARG00000056438 I 0.000
her6 Danio rerio ENSDARG00000006514 I 0.000
ENSCSAG00000008869 Chlorocebus sabaeus ENSCSAG00000008869 I 0.000
ENSAMEG00000015855 Ailuropoda melanoleuca ENSAMEG00000015855 I 0.000
ENSAMXG00000012278 Astyanax mexicanus ENSAMXG00000012278 I 0.000
ENSAMXG00000012796 Astyanax mexicanus ENSAMXG00000012796 I 0.000
ENSAPLG00000008077 Anas platyrhynchos ENSAPLG00000008077 I 0.000
HES1 Bos taurus ENSBTAG00000000569 I 0.000
HES4 Bos taurus ENSBTAG00000014705 I 0.000
HES4 Canis familiaris ENSCAFG00000019350 I 0.000
HES1 Choloepus hoffmanni ENSCHOG00000005633 I 0.000
HES1 Callithrix jacchus ENSCJAG00000014044 I 0.000
ENSCPOG00000021042 Cavia porcellus ENSCPOG00000021042 I 0.000
ENSCSAG00000000668 Chlorocebus sabaeus ENSCSAG00000000668 I 0.000
HES4 Gorilla gorilla ENSGGOG00000013399 I 0.000
ENSGMOG00000000092 Gadus morhua ENSGMOG00000000092 I 0.000
ENSGMOG00000015708 Gadus morhua ENSGMOG00000015708 I 0.000
ENSMPUG00000003643 Mustela putorius furo ENSMPUG00000003643 I 0.000
ENSMPUG00000006870 Mustela putorius furo ENSMPUG00000006870 I 0.000
ENSMPUG00000013915 Mustela putorius furo ENSMPUG00000013915 I 0.000
ENSNLEG00000006836 Nomascus leucogenys ENSNLEG00000006836 I 0.000
HES1 Ornithorhynchus anatinus ENSOANG00000015683 I 0.000
ENSOARG00000007304 Ovis aries ENSOARG00000007304 I 0.000
ENSOARG00000020422 Ovis aries ENSOARG00000020422 I 0.000
HES1 Oryctolagus cuniculus ENSOCUG00000009363 I 0.000
HES1 Otolemur garnettii ENSOGAG00000032425 I 0.000
ENSONIG00000002398 Oreochromis niloticus ENSONIG00000002398 I 0.000
ENSONIG00000002619 Oreochromis niloticus ENSONIG00000002619 I 0.000
ENSMODG00000019833 Monodelphis domestica ENSMODG00000019833 I 0.000
HES4 Monodelphis domestica ENSMODG00000018647 I 0.000
HES4 Macaca mulatta ENSMMUG00000001817 I 0.000
ENSGMOG00000018048 Gadus morhua ENSGMOG00000018048 I 0.000
ENSLACG00000009729 Latimeria chalumnae ENSLACG00000009729 I 0.000
ENSLACG00000017918 Latimeria chalumnae ENSLACG00000017918 I 0.000
HES1 Loxodonta africana ENSLAFG00000008932 I 0.000
ENSLOCG00000004988 Lepisosteus oculatus ENSLOCG00000004988 I 0.000
ENSLOCG00000007298 Lepisosteus oculatus ENSLOCG00000007298 I 0.000
ENSMEUG00000013941 Macropus eugenii ENSMEUG00000013941 I 0.000
HES1 Meleagris gallopavo ENSMGAG00000007566 I 0.000
ENSMICG00000012430 Microcebus murinus ENSMICG00000012430 I 0.000
HES4 Microcebus murinus ENSMICG00000015660 I 0.000
HES1 Myotis lucifugus ENSMLUG00000008549 I 0.000
ENSONIG00000010641 Oreochromis niloticus ENSONIG00000010641 I 0.000