LPERR04G16190 (Leersia perrieri)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 LPERR04G16190 T330966_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.674 0.932
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.644 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.644 0.886
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
LPERR04G16190.1 Sox 166 209

Links

Other Sox family TFs
Other Leersia perrieri TFs

522 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
BHLH039 Arabidopsis lyrata fgenesh1_pm.C_scaffold_5001751 N 0.000
Bostr.20505s0055 Boechera stricta Bostr.20505s0055 N 0.000
Bostr.20505s0056 Boechera stricta Bostr.20505s0056 N 0.000
Bo01495s010 Brassica oleracea Bo01495s010 N 0.000
Bo6g072510 Brassica oleracea Bo6g072510 N 0.000
Bo6g072500 Brassica oleracea Bo6g072500 N 0.000
Bo4g112590 Brassica oleracea Bo4g112590 N 0.000
Bra003260 Brassica rapa Bra003260 N 0.000
Bra014654 Brassica rapa Bra014654 N 0.000
Bra014658 Brassica rapa Bra014658 N 0.000
Bra014657 Brassica rapa Bra014657 N 0.000
Cagra.0578s0028 Capsella grandiflora Cagra.0578s0028 N 0.000
Carubv10017770m.g Capsella rubella Carubv10017770m.g N 0.000
MDP0000641681 Malus domestica MDP0000641681 N 0.000
Pm031098 Prunus mume Pm031098 N 0.000
Pm028949 Prunus mume Pm028949 N 0.000
Pm028948 Prunus mume Pm028948 N 0.000
PRUPE_ppa018670mg Prunus persica PRUPE_ppa018670mg N 0.000
PRUPE_ppa017407mg Prunus persica PRUPE_ppa017407mg N 0.000