MTR_4g025900 (Medicago truncatula)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 MTR_4g025900 T331375_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.712 0.977
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.678 0.909
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.678 0.909
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
KEH29133 Sox 137 180

Links

Other Sox family TFs
Other Medicago truncatula TFs

529 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
A1O1_00425 Capronia coronata A1O1_00425 N 0.000
A1O9_01477 Exophiala aquamarina A1O9_01477 N 0.000
ACLA_003930 Aspergillus clavatus CADACLAG00000315 N 0.000
ACLA_081950 Aspergillus clavatus CADACLAG00008081 N 0.000
ACLA_094500 Aspergillus clavatus CADACLAG00008494 N 0.000
ACRE_081730 Acremonium chrysogenum ACRE_081730 N 0.000
AFUA_6G07780 Aspergillus fumigatus CADAFUAG00001723 N 0.000
ANIA_01924 Aspergillus nidulans CADANIAG00008584 N 0.000
AOL_s00210g246 Arthrobotrys oligospora AOL_s00210g246 N 0.000
BBA_02604 Beauveria bassiana BBA_02604 N 0.000
Bcin13g02910 Botrytis cinerea Bcin13g02910 N 0.000
BDDG_05783 Blastomyces dermatitidis BDDG_05783 N 0.000
BGHDH14_bgh00899 Blumeria graminis BGHDH14_bgh00899 N 0.000
CADAFLAG00003021 Aspergillus flavus CADAFLAG00003021 N 0.000
CADAFLAG00006464 Aspergillus flavus CADAFLAG00006464 N 0.000
CADANGAG00008607 Aspergillus niger CADANGAG00008607 N 0.000
CCM_03073 Cordyceps militaris CCM_03073 N 0.000
CCM_04463 Cordyceps militaris CCM_04463 N 0.000
CFIO01_03461 Colletotrichum fioriniae CFIO01_03461 N 0.000
CH063_13085 Colletotrichum higginsianum CH063_13085 N 0.000
CIMG_01270 Coccidioides immitis CIMG_01270 N 0.000
CMQ_3880 Grosmannia clavigera CMQ_3880 N 0.000
Cob_10938 Colletotrichum orbiculare Cob_10938 N 0.000
CPC735_051300 Coccidioides posadasii CPC735_051300 N 0.000
CTHT_0043160 Chaetomium thermophilum CTHT_0043160 N 0.000
DRE_04388 Drechslerella stenobrocha DRE_04388 N 0.000
EPUS_01750 Endocarpon pusillum EPUS_01750 N 0.000
estExt_fgenesh3_kg.C_60109 Neurospora discreta estExt_fgenesh3_kg.C_60109 N 0.000
estExt_Genewise1Plus.C_90296 Cryphonectria parasitica estExt_Genewise1Plus.C_90296 N 0.000
estExt_Genewise1Plus.C_sca_2_chr3_3_00374 Nectria haematococca estExt_Genewise1Plus.C_sca_2_chr3_3_00374 N 0.000
EURHEDRAFT_515456 Aspergillus ruber EURHEDRAFT_515456 N 0.000
EV44_g6401 Erysiphe necator EV44_g6401 N 0.000
F503_00791 Ophiostoma piceae uamh F503_00791 N 0.000
FFUJ_05884 Fusarium fujikuroi FFUJ_05884 N 0.000
fgenesh1_pm.00118_#_476 Aspergillus carbonarius fgenesh1_pm.00118_#_476 N 0.000
FGRRES_08393 Fusarium graminearum FGRRES_08393 N 0.000
FOXG_03428 Fusarium oxysporum FOXG_03428 N 0.000
FPSE_09009 Fusarium pseudograminearum FPSE_09009 N 0.000
FVEG_02301 Fusarium verticillioides FVEG_02301 N 0.000
G647_00495 Cladophialophora carrionii G647_00495 N 0.000
GGTG_07704 Gaeumannomyces graminis GGTG_07704 N 0.000
GMDG_02924 Pseudogymnoascus destructans GMDG_02924 N 0.000
GSTUM_00006959001 Tuber melanosporum GSTUM_00006959001 N 0.000
H072_4961 Dactylellina haptotyla H072_4961 N 0.000
H101_07776 Trichophyton interdigitale H101_07776 N 0.000
H102_07414 Trichophyton rubrum H102_07414 N 0.000
H105_07444 Trichophyton soudanense H105_07444 N 0.000
HCBG_03077 Histoplasma capsulatum HCBG_03077 N 0.000
MAPG_11122 Magnaporthe poae MAPG_11122 N 0.000
MBM_06382 Marssonina brunnea MBM_06382 N 0.000
MCYG_00496 Arthroderma otae MCYG_00496 N 0.000
MCYG_00496 Microsporum canis MCYG_00496 N 0.000
MGG_07205 Magnaporthe oryzae MGG_07205 N 0.000
MGYG_01467 Microsporum gypseum MGYG_01467 N 0.000
MPH_10062 Macrophomina phaseolina MPH_10062 N 0.000
MYCTH_2307010 Myceliophthora thermophila MYCTH_2307010 N 0.000
NCU04830 Neurospora crassa NCU04830 N 0.000
NechaG67124 Fusarium solani NechaG67124 N 0.000
NEUTE1DRAFT_68581 Neurospora tetrasperma NEUTE1DRAFT_68581 N 0.000
NFIA_033490 Neosartorya fischeri CADNFIAG00003176 N 0.000
OCS_00082 Ophiocordyceps sinensis OCS_00082 N 0.000
OIDMADRAFT_136366 Oidiodendron maius OIDMADRAFT_136366 N 0.000
PAAG_08210 Paracoccidioides sp lutzii PAAG_08210 N 0.000
PABG_07429 Paracoccidioides brasiliensis PABG_07429 N 0.000
Pc12g09470 Penicillium chrysogenum Pc12g09470 N 0.000
Pc15g01300 Penicillium chrysogenum Pc15g01300 N 0.000
PCH_Pc12g09470 Penicillium rubens PCH_Pc12g09470 N 0.000
PCH_Pc15g01300 Penicillium rubens PCH_Pc15g01300 N 0.000
PDE_08869 Penicillium oxalicum PDE_08869 N 0.000
PITC_095770 Penicillium italicum PITC_095770 N 0.000
PMAA_030720 Penicillium marneffei PMAA_030720 N 0.000
PMAA_030720 Talaromyces marneffei PMAA_030720 N 0.000
PODANS_4_9520 Podospora anserina PODANS_4_9520 N 0.000
PV04_01613 Capronia semiimmersa PV04_01613 N 0.000
PV05_11393 Exophiala xenobiotica PV05_11393 N 0.000
PV06_03188 Exophiala oligosperma PV06_03188 N 0.000
PV06_11178 Exophiala oligosperma PV06_11178 N 0.000
PV07_10227 Cladophialophora immunda PV07_10227 N 0.000
PV08_05648 Exophiala spinifera PV08_05648 N 0.000
PV10_03312 Exophiala mesophila PV10_03312 N 0.000
PV11_07688 Exophiala sideris PV11_07688 N 0.000
PVAR5_3942 Byssochlamys spectabilis PVAR5_3942 N 0.000
PVAR5_6218 Byssochlamys spectabilis PVAR5_6218 N 0.000
S40285_02676 Stachybotrys chlorohalonata S40285_02676 N 0.000
S40288_06143 Stachybotrys chartarum S40288_06143 N 0.000
SBOR_7105 Sclerotinia borealis SBOR_7105 N 0.000
SMAC_03468 Sordaria macrospora SMAC_03468 N 0.000
SPBR_01466 Sporothrix brasiliensis SPBR_01466 N 0.000
SS1G_09554 Sclerotinia sclerotiorum SS1G_09554 N 0.000
TEQG_06860 Trichophyton equinum TEQG_06860 N 0.000
TESG_04226 Trichophyton tonsurans TESG_04226 N 0.000
TRIATDRAFT_131396 Trichoderma atroviride TRIATDRAFT_131396 N 0.000
TRIREDRAFT_3856 Trichoderma reesei TRIREDRAFT_3856 N 0.000
TRIVIDRAFT_36706 Trichoderma virens TRIVIDRAFT_36706 N 0.000
TRV_00538 Trichophyton verrucosum TRV_00538 N 0.000
TSTA_002440 Talaromyces stipitatus TSTA_002440 N 0.000
TSTA_067470 Talaromyces stipitatus TSTA_067470 N 0.000
U727_00433560211 Penicillium solitum U727_00433560211 N 0.000
UREG_01201 Uncinocarpus reesii UREG_01201 N 0.000
V499_02602 Pseudogymnoascus pannorum V499_02602 N 0.000
VDAG_07460 Verticillium dahliae VDAG_07460 N 0.000
VDBG_09306 Verticillium alfalfae VDBG_09306 N 0.000
VDBG_09306 Verticillium albo atrum VDBG_09306 N 0.000
VHEMI06722 Torrubiella hemipterigena VHEMI06722 N 0.000