MTR_4g025900 (Medicago truncatula)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 MTR_4g025900 T331375_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.712 0.977
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.678 0.909
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.678 0.909
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
KEH29133 Sox 137 180

Links

Other Sox family TFs
Other Medicago truncatula TFs

529 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACRE_033820 Acremonium chrysogenum ACRE_033820 I 0.000
BBA_08070 Beauveria bassiana BBA_08070 I 0.000
CHGG_02757 Chaetomium globosum CHGG_02757 I 0.000
CTHT_0010020 Chaetomium thermophilum CTHT_0010020 N 0.000
CPUR_08341 Claviceps purpurea CPUR_08341 I 0.000
CFIO01_08122 Colletotrichum fioriniae CFIO01_08122 I 0.000
CGGC5_8345 Colletotrichum gloeosporioides CGGC5_8345 I 0.000
GLRG_03859 Colletotrichum graminicola GLRG_03859 I 0.000
Cob_01744 Colletotrichum orbiculare Cob_01744 I 0.000
CCM_06587 Cordyceps militaris CCM_06587 I 0.000
e_gw1.4.1107.1 Cryphonectria parasitica e_gw1.4.1107.1 N 0.000
FFUJ_01489 Fusarium fujikuroi FFUJ_01489 I 0.000
FGRRES_01293 Fusarium graminearum FGRRES_01293 I 0.000
FOXG_00092 Fusarium oxysporum FOXG_00092 I 0.000
FPSE_11604 Fusarium pseudograminearum FPSE_11604 I 0.000
NechaG31414 Fusarium solani NechaG31414 I 0.000
FVEG_01423 Fusarium verticillioides FVEG_01423 I 0.000
GGTG_14005 Gaeumannomyces graminis GGTG_14005 I 0.000
CMQ_1676 Grosmannia clavigera CMQ_1676 I 0.000
MGG_16444 Magnaporthe oryzae MGG_16444 I 0.000
MAPG_06552 Magnaporthe poae MAPG_06552 I 0.000
MBM_09780 Marssonina brunnea MBM_09780 I 0.000
MAC_07128 Metarhizium acridum MAC_07128 I 0.000
MAM_03637 Metarhizium album MAM_03637 I 0.000
MANI_013516 Metarhizium anisopliae MANI_013516 I 0.000
MBR_06050 Metarhizium brunneum MBR_06050 I 0.000
MGU_10384 Metarhizium guizhouense MGU_10384 I 0.000
MAJ_04538 Metarhizium majus MAJ_04538 I 0.000
X797_005812 Metarhizium robertsii X797_005812 I 0.000
MYCTH_2296636 Myceliophthora thermophila MYCTH_2296636 I 0.000
e_gw1.1.808.1 Nectria haematococca e_gw1.1.808.1 I 0.000
estExt_fgenesh2_pg.C_20771 Neurospora discreta estExt_fgenesh2_pg.C_20771 I 0.000
NEUTE1DRAFT_72988 Neurospora tetrasperma NEUTE1DRAFT_72988 D 0.000
OCS_04027 Ophiocordyceps sinensis OCS_04027 I 0.000
F503_06980 Ophiostoma piceae uamh F503_06980 I 0.000
PFICI_01957 Pestalotiopsis fici PFICI_01957 I 0.000
PODANS_1_13830 Podospora anserina PODANS_1_13830 I 0.000
SAPIO_CDS6802 Scedosporium apiospermum SAPIO_CDS6802 I 0.000
SMAC_04265 Sordaria macrospora SMAC_04265 I 0.000
SPBR_02275 Sporothrix brasiliensis SPBR_02275 I 0.000
HMPREF1624_02516 Sporothrix schenckii HMPREF1624_02516 I 0.000
S40285_08198 Stachybotrys chlorohalonata S40285_08198 I 0.000
THITE_2113102 Thielavia terrestris THITE_2113102 I 0.000
VHEMI08908 Torrubiella hemipterigena VHEMI08908 I 0.000
TRIATDRAFT_148646 Trichoderma atroviride TRIATDRAFT_148646 I 0.000
TRIREDRAFT_57760 Trichoderma reesei TRIREDRAFT_57760 I 0.000
TRIVIDRAFT_80393 Trichoderma virens TRIVIDRAFT_80393 I 0.000
VDAG_08832 Verticillium dahliae VDAG_08832 I 0.000