OBART03G27740 (Oryza barthii)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 OBART03G27740 T331570_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.731 0.909
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.706 0.932
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.706 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.654 0.659
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.654 0.659
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.602 0.773
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
OBART03G27740.1 Sox 113 156

Links

Other Sox family TFs
Other Oryza barthii TFs

532 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
YAB2 Oryza sativa OS03G0650000 I 0.741
F775_28710 Aegilops tauschii F775_28710 I 0.741
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.741
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.741
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.741
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.741
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.741
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.741
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.741
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.741
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.741
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.741
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.741
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.741
Si023308m.g Setaria italica Si023308m.g I 0.741
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.741
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.741
YAB6 Oryza sativa OS12G0621100 I 0.741
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.741
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.741
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.741
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.741
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.741
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.741
OB03G35470 Oryza brachyantha OB03G35470 I 0.741
OB12G26050 Oryza brachyantha OB12G26050 I 0.741
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.741
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.741
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.741
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.741
OBART12G19190 Oryza barthii OBART12G19190 I 0.741
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.741
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.741
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.741
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.741
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.741
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.741
Si037789m.g Setaria italica Si037789m.g I 0.737
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.737
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.737
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.737
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.737
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.735
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.735
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.735
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.735
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.734
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.731
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.731
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.731
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.731
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.731
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.731
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.731
OB07G12810 Oryza brachyantha OB07G12810 I 0.731
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.731
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.731
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.731
YAB1 Oryza sativa OS07G0160100 I 0.731
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.731
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.731
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.731
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.731
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.731
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.731
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.731
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.731
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.731
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.731
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.731
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.731
MDP0000331808 Malus domestica MDP0000331808 I 0.731
MDP0000366291 Malus domestica MDP0000366291 I 0.731
MDP0000500810 Malus domestica MDP0000500810 I 0.731
MDP0000252640 Malus domestica MDP0000252640 I 0.731
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.731
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.731
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.731
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.731
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.731
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.731
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.731
Ca_07101 Cicer arietinum Ca_07101 I 0.731
Cla008752 Citrullus lanatus Cla008752 I 0.731
TCM_041175 Theobroma cacao TCM_041175 I 0.731
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.731
AFO Arabidopsis lyrata scaffold_403460.1 I 0.731
Si030811m.g Setaria italica Si030811m.g I 0.731
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.731
Pm001547 Prunus mume Pm001547 I 0.731
29854.m001136 Ricinus communis 29854.m001136 I 0.731
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.731
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.731
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.731
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.731
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.731
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.731
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.731
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.731
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.731
Bra031629 Brassica rapa Bra031629 I 0.731
Bo3g037630 Brassica oleracea Bo3g037630 I 0.731
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.731
Bo4g195410 Brassica oleracea Bo4g195410 I 0.731
Bra030728 Brassica rapa Bra030728 I 0.731
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.731
YAB2 Arabidopsis thaliana AT1G08465 I 0.731
Bra000378 Brassica rapa Bra000378 I 0.731
YAB1 Arabidopsis thaliana AT2G45190 D 0.731
Bo5g009010 Brassica oleracea Bo5g009010 I 0.731
Bo6g073320 Brassica oleracea Bo6g073320 I 0.731
Bra037320 Brassica rapa Bra037320 I 0.731
Bra040322 Brassica rapa Bra040322 I 0.731
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.731
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.731
Bo8g112450 Brassica oleracea Bo8g112450 I 0.731
Bo9g001130 Brassica oleracea Bo9g001130 I 0.731
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.731
Bra018624 Brassica rapa Bra018624 I 0.731
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.731
YAB3 Arabidopsis thaliana AT4G00180 I 0.731
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.731
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.731
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.731
PK06964.1 Cannabis sativa PK06964.1 I 0.731
Bra003309 Brassica rapa Bra003309 I 0.731
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.731
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.730
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.729
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.726
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.725
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.725
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.725
Bo8g055830 Brassica oleracea Bo8g055830 I 0.724
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.720
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.720
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.716
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.709
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.708
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.707
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.706
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.706
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.706
MDP0000255415 Malus domestica MDP0000255415 I 0.706
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.706
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.706
29927.m000626 Ricinus communis 29927.m000626 I 0.706
Bo3g041840 Brassica oleracea Bo3g041840 I 0.706
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.706
mgf010765m Mimulus guttatus mgf010765m I 0.706
PK09461.1 Cannabis sativa PK09461.1 I 0.706
Bra000538 Brassica rapa Bra000538 I 0.706
Pm027559 Prunus mume Pm027559 I 0.706
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.706
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.706
mgf015972m Mimulus guttatus mgf015972m I 0.706
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.706
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.706
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.706
YAB5 Arabidopsis thaliana AT2G26580 D 0.706
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.706
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.706
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.706
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.706
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.706
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.706
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.706
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.706
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.706
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.706
TCM_038105 Theobroma cacao TCM_038105 I 0.706
Ca_06681 Cicer arietinum Ca_06681 I 0.706
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.706
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.706
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.706
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.703
28200.m000191 Ricinus communis 28200.m000191 I 0.702
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.702
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.702
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.702
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.702
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.702
30174.m008839 Ricinus communis 30174.m008839 I 0.702
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.702
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.702
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.702
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.702
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.702
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.702
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.702
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.702
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.702
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.702
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.702
Ca_25981 Cicer arietinum Ca_25981 I 0.702
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.702
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.702
Pm017846 Prunus mume Pm017846 I 0.702
Pm023555 Prunus mume Pm023555 I 0.702
YAB3 Oryza sativa OS10G0508300 I 0.702
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.702
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.702
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.702
Cla011745 Citrullus lanatus Cla011745 I 0.702
YAB4 Oryza sativa OS02G0643200 I 0.702
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.702
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.702
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.702
TCM_005549 Theobroma cacao TCM_005549 I 0.702
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.702
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.702
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.702
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.702
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.702
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.702
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.702
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.702
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.702
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.702
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.702
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.702
MDP0000192940 Malus domestica MDP0000192940 I 0.702
MDP0000298333 Malus domestica MDP0000298333 I 0.702
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.702
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.702
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.702
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.702
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.702
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.702
Si036788m.g Setaria italica Si036788m.g I 0.702
OB02G33040 Oryza brachyantha OB02G33040 I 0.702
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.702
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.702
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.702
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.702
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.702
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.702
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.702
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.702
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.702
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.702
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.702
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.702
mgf003166m Mimulus guttatus mgf003166m I 0.702
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.702
OBART02G25670 Oryza barthii OBART02G25670 I 0.702
mgf011463m Mimulus guttatus mgf011463m I 0.702
mgf015806m Mimulus guttatus mgf015806m I 0.702
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.702
OBART10G15260 Oryza barthii OBART10G15260 I 0.702
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.701
Cla012424 Citrullus lanatus Cla012424 I 0.701
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.701
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.701
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.701
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.699
mgf009982m Mimulus guttatus mgf009982m I 0.697
mgf019496m Mimulus guttatus mgf019496m I 0.697
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.697
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.697
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.697
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.697
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.697
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.696
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.696
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.693
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.686
TCM_011484 Theobroma cacao TCM_011484 I 0.683
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.683
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.683
mgf007067m Mimulus guttatus mgf007067m I 0.683
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.683
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.683
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.683
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.683
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.683
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.683
Ca_18533 Cicer arietinum Ca_18533 I 0.683
Ca_12379 Cicer arietinum Ca_12379 I 0.683
Cla010397 Citrullus lanatus Cla010397 I 0.683
Pm030598 Prunus mume Pm030598 I 0.683
30174.m009083 Ricinus communis 30174.m009083 I 0.683
CRC Vitis vinifera VIT_01s0011g00140 I 0.683
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.683
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.683
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.683
PK13838.1 Cannabis sativa PK13838.1 I 0.683
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.683
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.683
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.677
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.677
Cla005767 Citrullus lanatus Cla005767 I 0.675
INO Vitis vinifera VIT_01s0127g00330 I 0.675
F775_25525 Aegilops tauschii F775_25525 I 0.672
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.672
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.672
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.672
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.671
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.669
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.669
F775_27799 Aegilops tauschii F775_27799 I 0.668
YAB5 Oryza sativa OS04G0536300 I 0.668
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.668
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.668
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.668
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.668
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.668
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.668
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.668
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.668
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.668
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.668
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.668
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.668
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.668
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.668
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.668
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.668
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.668
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.668
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.668
OBART04G20010 Oryza barthii OBART04G20010 I 0.668
OB04G27010 Oryza brachyantha OB04G27010 I 0.668
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.668
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.668
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.668
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.668
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.668
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.668
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.668
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.668
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.668
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.668
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.668
Si018146m.g Setaria italica Si018146m.g I 0.668
TCM_016030 Theobroma cacao TCM_016030 I 0.668
Si010859m.g Setaria italica Si010859m.g I 0.668
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.668
Cla016962 Citrullus lanatus Cla016962 I 0.667
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.667
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.665
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.665
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.664
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.661
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.659
TCM_031868 Theobroma cacao TCM_031868 I 0.659
Bra004364 Brassica rapa Bra004364 I 0.654
MDP0000291729 Malus domestica MDP0000291729 I 0.654
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.654
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.654
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.654
CRC Arabidopsis thaliana AT1G69180 D 0.654
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.654
MDP0000171878 Malus domestica MDP0000171878 I 0.654
Bo6g108630 Brassica oleracea Bo6g108630 I 0.654
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.654
MDP0000124879 Malus domestica MDP0000124879 I 0.654
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.651
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.651
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.651
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.651
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.651
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.651
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.651
OB03G18700 Oryza brachyantha OB03G18700 I 0.651
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.651
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.651
mgf001016m Mimulus guttatus mgf001016m I 0.651
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.651
OBART03G08320 Oryza barthii OBART03G08320 I 0.651
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.651
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.651
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.651
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.651
OS03G0215200 Oryza sativa OS03G0215200 I 0.651
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.651
Si037608m.g Setaria italica Si037608m.g I 0.651
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.651
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.651
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.651
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.651
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.651
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.651
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.651
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.651
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.651
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.651
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.651
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.650
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.646
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.646
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.646
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.646
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.646
Pm006709 Prunus mume Pm006709 I 0.646
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.646
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.644
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.644
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.644
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.640
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.640
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.638
MDP0000263713 Malus domestica MDP0000263713 I 0.638
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.638
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.637
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.634
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.632
MDP0000126221 Malus domestica MDP0000126221 I 0.632
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.632
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.631
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.621
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.621
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.620
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.618
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.618
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.617
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.614
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.612
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.610
Cla000824 Citrullus lanatus Cla000824 I 0.607
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.607
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.605
Ca_21472 Cicer arietinum Ca_21472 I 0.603
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.602
INO Arabidopsis thaliana AT1G23420 D 0.602
Bo5g039580 Brassica oleracea Bo5g039580 I 0.602
Bra024599 Brassica rapa Bra024599 I 0.602
Bra012373 Brassica rapa Bra012373 I 0.602
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.602
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.602
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.602
Bo7g056180 Brassica oleracea Bo7g056180 I 0.602
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.602
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.599
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.594
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.587
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.574
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.574
OB07G25220 Oryza brachyantha OB07G25220 I 0.574
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.574
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.574
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.574
Cla010239 Citrullus lanatus Cla010239 I 0.573
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.573
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.573
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.573
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.570
mgf023167m Mimulus guttatus mgf023167m I 0.569
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.567
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.564
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.553
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.553
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.547
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.547
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.538
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
Moror_16065 Moniliophthora roreri Moror_16065 I 0.522
29631.m001046 Ricinus communis 29631.m001046 I 0.520
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.479
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.477
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.472
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.472
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.470
PV09_07652 Verruconis gallopava PV09_07652 I 0.468
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.467
CND03770 Cryptococcus neoformans CND03770 I 0.467
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
sr16632 Sporisorium reilianum sr16632 I 0.464
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.456
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.440
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.440
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.440
EMIHUDRAFT_117867 Emiliania huxleyi EMIHUDRAFT_117867 I 0.440
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.440
mgf012563m Mimulus guttatus mgf012563m I 0.439
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.437
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.437
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.435
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.435
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.434
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
GB50764 Apis mellifera GB50764 I 0.433
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.433
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.433
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.433
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.433
Si007288m.g Setaria italica Si007288m.g I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.431
UM06001 Ustilago maydis UM06001 I 0.430
Hba_16915 Heterorhabditis bacteriophora Hba_16915 I 0.429
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.427
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.427
MDOA001488 Musca domestica MDOA001488 I 0.427
GH18160 Drosophila grimshawi FBgn0125628 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.427
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.427
GK13574 Drosophila willistoni FBgn0215582 I 0.427
GE25578 Drosophila yakuba FBgn0242642 I 0.427
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.425
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.425
ENSCING00000000505 Ciona intestinalis ENSCING00000000505 I 0.423
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.422
THITE_22048 Thielavia terrestris THITE_22048 I 0.422
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
KGM_20190 Danaus plexippus KGM_20190 I 0.416
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.416
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.416
E5Q_04235 Mixia osmundae E5Q_04235 I 0.416
E5Q_04236 Mixia osmundae E5Q_04236 I 0.416
NV13812 Nasonia vitripennis NV13812 I 0.416
MCINX012524 Melitaea cinxia MCINX012524 I 0.416
XP_002163918.1 Hydra magnipapillata XP_002163918.1 I 0.415
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415