ORGLA07G0250200 (Oryza glaberrima)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 ORGLA07G0250200 T331681_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.609 0.633
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.574 0.612
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.574 0.612
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.574 0.592
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.539 0.551
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.539 0.551
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
ORGLA07G0250200.1 Sox 116 164

Links

Other Sox family TFs
Other Oryza glaberrima TFs

504 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.741
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.741
OB07G25220 Oryza brachyantha OB07G25220 I 0.741
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.736
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.697
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.686
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.686
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.650
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.650
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.649
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.648
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.643
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.640
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.637
mgf023167m Mimulus guttatus mgf023167m I 0.614
MDP0000126221 Malus domestica MDP0000126221 I 0.613
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.609
Bo5g039580 Brassica oleracea Bo5g039580 I 0.609
Bra012373 Brassica rapa Bra012373 I 0.609
Bo7g056180 Brassica oleracea Bo7g056180 I 0.609
Bra024599 Brassica rapa Bra024599 I 0.609
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.609
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.609
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.609
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.609
INO Arabidopsis thaliana AT1G23420 D 0.609
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.608
Cla010239 Citrullus lanatus Cla010239 I 0.608
mgf009982m Mimulus guttatus mgf009982m I 0.608
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.608
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.608
Cla016962 Citrullus lanatus Cla016962 I 0.608
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.608
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.608
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.608
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.608
INO Vitis vinifera VIT_01s0127g00330 I 0.607
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.607
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.607
MDP0000263713 Malus domestica MDP0000263713 I 0.607
Pm006709 Prunus mume Pm006709 I 0.607
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.603
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.603
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.603
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.603
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.603
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.602
TCM_031868 Theobroma cacao TCM_031868 I 0.602
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.595
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.589
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.586
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.585
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.585
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.585
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.585
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.584
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.584
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.584
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.584
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.584
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.581
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.580
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.579
Si010859m.g Setaria italica Si010859m.g I 0.579
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.579
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.579
Si018146m.g Setaria italica Si018146m.g I 0.579
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.579
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.579
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.579
YAB5 Oryza sativa OS04G0536300 I 0.579
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.579
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.579
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.579
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.579
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.579
OB04G27010 Oryza brachyantha OB04G27010 I 0.579
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.579
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.579
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.579
OBART04G20010 Oryza barthii OBART04G20010 I 0.579
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.579
TCM_016030 Theobroma cacao TCM_016030 I 0.579
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.579
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.579
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.579
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.579
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.579
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.579
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.579
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.579
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.579
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.579
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.579
F775_27799 Aegilops tauschii F775_27799 I 0.579
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.579
F775_25525 Aegilops tauschii F775_25525 I 0.579
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.579
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.579
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.579
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.579
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.579
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.579
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.579
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.579
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.574
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.574
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.574
MDP0000252640 Malus domestica MDP0000252640 I 0.574
Pm027559 Prunus mume Pm027559 I 0.574
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.574
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.574
Cla008752 Citrullus lanatus Cla008752 I 0.574
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.574
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.574
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.574
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.574
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.574
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.574
29927.m000626 Ricinus communis 29927.m000626 I 0.574
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.574
MDP0000331808 Malus domestica MDP0000331808 I 0.574
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.574
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.574
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.574
MDP0000366291 Malus domestica MDP0000366291 I 0.574
29854.m001136 Ricinus communis 29854.m001136 I 0.574
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.574
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.574
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.574
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.574
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.574
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.574
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.574
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.574
MDP0000255415 Malus domestica MDP0000255415 I 0.574
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.574
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.574
AFO Arabidopsis lyrata scaffold_403460.1 I 0.574
Si023308m.g Setaria italica Si023308m.g I 0.574
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.574
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.574
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.574
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.574
Si030811m.g Setaria italica Si030811m.g I 0.574
Cla012424 Citrullus lanatus Cla012424 I 0.574
YAB2 Oryza sativa OS03G0650000 I 0.574
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.574
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.574
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.574
YAB6 Oryza sativa OS12G0621100 I 0.574
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.574
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.574
YAB1 Oryza sativa OS07G0160100 I 0.574
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.574
Ca_07101 Cicer arietinum Ca_07101 I 0.574
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.574
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.574
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.574
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.574
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.574
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.574
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.574
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.574
TCM_041175 Theobroma cacao TCM_041175 I 0.574
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.574
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.574
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.574
Si037789m.g Setaria italica Si037789m.g I 0.574
Pm001547 Prunus mume Pm001547 I 0.574
Ca_06681 Cicer arietinum Ca_06681 I 0.574
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.574
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.574
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.574
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.574
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.574
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.574
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.574
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.574
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.574
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.574
Bra037320 Brassica rapa Bra037320 I 0.574
Bra031629 Brassica rapa Bra031629 I 0.574
Bra040322 Brassica rapa Bra040322 I 0.574
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.574
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.574
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.574
mgf019496m Mimulus guttatus mgf019496m I 0.574
mgf010765m Mimulus guttatus mgf010765m I 0.574
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.574
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.574
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.574
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.574
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.574
mgf015972m Mimulus guttatus mgf015972m I 0.574
F775_28710 Aegilops tauschii F775_28710 I 0.574
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.574
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.574
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.574
Bra030728 Brassica rapa Bra030728 I 0.574
Bra018624 Brassica rapa Bra018624 I 0.574
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.574
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.574
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.574
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.574
Bo3g037630 Brassica oleracea Bo3g037630 I 0.574
YAB3 Arabidopsis thaliana AT4G00180 I 0.574
YAB1 Arabidopsis thaliana AT2G45190 D 0.574
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.574
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.574
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.574
YAB2 Arabidopsis thaliana AT1G08465 I 0.574
YAB5 Arabidopsis thaliana AT2G26580 D 0.574
Bo3g041840 Brassica oleracea Bo3g041840 I 0.574
Bo4g195410 Brassica oleracea Bo4g195410 I 0.574
Bra000378 Brassica rapa Bra000378 I 0.574
PK06964.1 Cannabis sativa PK06964.1 I 0.574
Bra000538 Brassica rapa Bra000538 I 0.574
Bra003309 Brassica rapa Bra003309 I 0.574
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.574
Bo9g001130 Brassica oleracea Bo9g001130 I 0.574
Bo8g112450 Brassica oleracea Bo8g112450 I 0.574
Bo5g009010 Brassica oleracea Bo5g009010 I 0.574
Bo6g073320 Brassica oleracea Bo6g073320 I 0.574
PK09461.1 Cannabis sativa PK09461.1 I 0.574
Bo8g055830 Brassica oleracea Bo8g055830 I 0.574
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.574
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.574
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.574
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.574
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.574
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.574
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.574
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.574
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.574
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.574
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.574
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.574
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.574
TCM_038105 Theobroma cacao TCM_038105 I 0.574
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.574
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.574
OBART03G27740 Oryza barthii OBART03G27740 I 0.574
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.574
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.574
OBART12G19190 Oryza barthii OBART12G19190 I 0.574
MDP0000500810 Malus domestica MDP0000500810 I 0.574
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.574
OB12G26050 Oryza brachyantha OB12G26050 I 0.574
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.574
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.574
OB03G35470 Oryza brachyantha OB03G35470 I 0.574
OB07G12810 Oryza brachyantha OB07G12810 I 0.574
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.574
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.574
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.574
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.574
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.574
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.574
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.574
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.574
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.574
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.574
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.574
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.574
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.574
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.574
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.574
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.574
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.574
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.574
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.574
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.574
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.574
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.574
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.574
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.574
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.574
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.574
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.574
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.573
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.573
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.573
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.573
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.573
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.573
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.573
mgf007067m Mimulus guttatus mgf007067m I 0.573
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.573
Cla000824 Citrullus lanatus Cla000824 I 0.573
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.573
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.568
CRC Vitis vinifera VIT_01s0011g00140 I 0.567
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.567
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.567
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.567
Cla010397 Citrullus lanatus Cla010397 I 0.567
Ca_18533 Cicer arietinum Ca_18533 I 0.567
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.567
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.567
30174.m009083 Ricinus communis 30174.m009083 I 0.567
Pm030598 Prunus mume Pm030598 I 0.567
Ca_12379 Cicer arietinum Ca_12379 I 0.567
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.567
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.567
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.567
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.567
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.567
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.567
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.567
OB03G18700 Oryza brachyantha OB03G18700 I 0.567
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.567
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.567
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.567
OBART03G08320 Oryza barthii OBART03G08320 I 0.567
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.567
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.567
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.567
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.567
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.567
PK13838.1 Cannabis sativa PK13838.1 I 0.567
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.567
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.567
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.567
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.567
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.567
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.567
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.567
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.567
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.567
Si037608m.g Setaria italica Si037608m.g I 0.567
OS03G0215200 Oryza sativa OS03G0215200 I 0.567
TCM_011484 Theobroma cacao TCM_011484 I 0.567
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.567
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.567
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.567
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.567
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.567
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.567
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.567
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.567
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.567
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.567
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.567
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.567
mgf001016m Mimulus guttatus mgf001016m I 0.565
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.563
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.563
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.563
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.561
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.561
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.561
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.561
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.561
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.560
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.559
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.558
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.557
Ca_21472 Cicer arietinum Ca_21472 I 0.557
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.557
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.545
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.545
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.545
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.545
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.545
MDP0000298333 Malus domestica MDP0000298333 I 0.545
MDP0000192940 Malus domestica MDP0000192940 I 0.545
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.545
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.545
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.545
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.545
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.545
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.545
MDP0000171878 Malus domestica MDP0000171878 I 0.545
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.545
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.545
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.545
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.545
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.545
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.545
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.545
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.545
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.545
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.545
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.545
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.545
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.545
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.545
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.545
YAB4 Oryza sativa OS02G0643200 I 0.545
YAB3 Oryza sativa OS10G0508300 I 0.545
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.545
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.545
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.545
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.545
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.545
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.545
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.545
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.545
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.545
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.545
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.545
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.545
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.545
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.545
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.545
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.545
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.545
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.545
OBART10G15260 Oryza barthii OBART10G15260 I 0.545
OBART02G25670 Oryza barthii OBART02G25670 I 0.545
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.545
OB02G33040 Oryza brachyantha OB02G33040 I 0.545
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.545
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.545
Pm023555 Prunus mume Pm023555 I 0.545
28200.m000191 Ricinus communis 28200.m000191 I 0.545
30174.m008839 Ricinus communis 30174.m008839 I 0.545
Pm017846 Prunus mume Pm017846 I 0.545
Cla011745 Citrullus lanatus Cla011745 I 0.545
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.545
Ca_25981 Cicer arietinum Ca_25981 I 0.545
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.545
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.545
mgf011463m Mimulus guttatus mgf011463m I 0.545
mgf015806m Mimulus guttatus mgf015806m I 0.545
mgf003166m Mimulus guttatus mgf003166m I 0.545
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.545
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.545
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.545
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.545
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.545
TCM_005549 Theobroma cacao TCM_005549 I 0.545
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.545
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.545
Si036788m.g Setaria italica Si036788m.g I 0.545
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.539
CRC Arabidopsis thaliana AT1G69180 D 0.539
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.539
Bo6g108630 Brassica oleracea Bo6g108630 I 0.539
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.539
Bra004364 Brassica rapa Bra004364 I 0.539
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.539
MDP0000291729 Malus domestica MDP0000291729 I 0.539
MDP0000124879 Malus domestica MDP0000124879 I 0.539
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.539
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.536
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.536
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.536
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.524
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.523
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.519
Cla005767 Citrullus lanatus Cla005767 I 0.518
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.518
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.517
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.501
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.496
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.493
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.490
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.485
CND03770 Cryptococcus neoformans CND03770 I 0.477
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.474
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.467
29631.m001046 Ricinus communis 29631.m001046 I 0.462
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.462
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.457
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.453
SCHCODRAFT_73620 Schizophyllum commune SCHCODRAFT_73620 N 0.453
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.451
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.451
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.448
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.447
UHOR_08529 Ustilago hordei UHOR_08529 I 0.446
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.445
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.444
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.444
TELCIR_25179 Teladorsagia circumcincta TELCIR_25179 N 0.443
NBR_0000051501 Nippostrongylus brasiliensis NBR_0000051501 N 0.443
TELCIR_19210 Teladorsagia circumcincta TELCIR_19210 N 0.443
HPBE_0002300401 Heligmosomoides bakeri HPBE_0002300401 N 0.443
sr16632 Sporisorium reilianum sr16632 I 0.440
UM06001 Ustilago maydis UM06001 I 0.440
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
M407DRAFT_28999 Tulasnella calospora M407DRAFT_28999 N 0.437
CC1G_06617 Coprinopsis cinerea CC1G_06617 N 0.436
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.436
GALMADRAFT_234655 Galerina marginata GALMADRAFT_234655 N 0.435
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.433
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.432
Moror_16065 Moniliophthora roreri Moror_16065 I 0.427
CMT447C Cyanidioschyzon merolae CMT447C I 0.426
E5Q_04235 Mixia osmundae E5Q_04235 I 0.426
E5Q_04236 Mixia osmundae E5Q_04236 I 0.426
PEQ_0000291001 Parascaris equorum PEQ_0000291001 I 0.425
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.425
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.425
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.425
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.425
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.425
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.425
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.425
GLOINDRAFT_338425 Rhizophagus irregularis GLOINDRAFT_338425 I 0.421
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.421
K443DRAFT_87716 Laccaria amethystina K443DRAFT_87716 N 0.419