PAXRUDRAFT_821077 (Paxillus rubicundulus)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 PAXRUDRAFT_821077 T331781_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.427 0.375
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.427 0.375
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
KIL01061 Sox 26 73

Links

Other Sox family TFs
Other Paxillus rubicundulus TFs

125 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
30174.m009083 Ricinus communis 30174.m009083 I 0.427
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.459
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.427
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.436
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.435
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.427
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.425
Bo6g108630 Brassica oleracea Bo6g108630 I 0.427
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.427
BOTBODRAFT_110075 Botryobasidium botryosum BOTBODRAFT_110075 N 0.438
Bra004364 Brassica rapa Bra004364 I 0.427
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.427
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.427
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.427
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.427
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.433
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.427
Ca_12379 Cicer arietinum Ca_12379 I 0.427
Ca_18533 Cicer arietinum Ca_18533 I 0.427
CC1G_06617 Coprinopsis cinerea CC1G_06617 N 0.543
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.427
Cla010397 Citrullus lanatus Cla010397 I 0.427
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.427
CRC Vitis vinifera VIT_01s0011g00140 I 0.427
CRC Arabidopsis thaliana AT1G69180 D 0.427
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.427
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.674
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.531
E5Q_04235 Mixia osmundae E5Q_04235 I 0.466
E5Q_04236 Mixia osmundae E5Q_04236 I 0.466
EMIHUDRAFT_208774 Emiliania huxleyi EMIHUDRAFT_208774 N 0.416
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.427
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.418
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.435
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.427
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.512
GALMADRAFT_234655 Galerina marginata GALMADRAFT_234655 N 0.619
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.427
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.522
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.661
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.427
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.427
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.427
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.427
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.427
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.432
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.427
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.427
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.427
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.433
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.427
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.423
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.423
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.432
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.425
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.427
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.427
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.420
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.461
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.512
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.661
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.454
K443DRAFT_87716 Laccaria amethystina K443DRAFT_87716 N 0.589
LACBIDRAFT_301226 Laccaria bicolor LACBIDRAFT_301226 N 0.589
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.427
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.425
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.427
M378DRAFT_228709 Amanita muscaria M378DRAFT_228709 N 0.574
M404DRAFT_998370 Pisolithus tinctorius M404DRAFT_998370 N 0.583
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.544
M407DRAFT_28999 Tulasnella calospora M407DRAFT_28999 N 0.430
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.530
MDP0000124879 Malus domestica MDP0000124879 I 0.427
MDP0000171878 Malus domestica MDP0000171878 I 0.427
MDP0000291729 Malus domestica MDP0000291729 I 0.427
mgf001016m Mimulus guttatus mgf001016m I 0.427
mgf007067m Mimulus guttatus mgf007067m I 0.427
MVLG_01899 Microbotryum violaceum MVLG_01899 N 0.431
OB03G18700 Oryza brachyantha OB03G18700 I 0.427
OB07G25220 Oryza brachyantha OB07G25220 I 0.425
OBART03G08320 Oryza barthii OBART03G08320 I 0.427
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.427
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.425
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.427
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.427
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.425
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.427
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.427
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.427
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.425
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.427
OS03G0215200 Oryza sativa OS03G0215200 I 0.427
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.425
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.425
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.427
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.427
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.427
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.425
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.427
PHACADRAFT_247984 Phanerochaete carnosa PHACADRAFT_247984 N 0.481
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.553
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.664
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.657
PK13838.1 Cannabis sativa PK13838.1 I 0.427
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.664
Pm030598 Prunus mume Pm030598 I 0.427
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.427
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.421
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.427
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.421
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.427
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.427
SCHCODRAFT_73620 Schizophyllum commune SCHCODRAFT_73620 N 0.617
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.667
Si037608m.g Setaria italica Si037608m.g I 0.427
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.427
sr16632 Sporisorium reilianum sr16632 I 0.425
TCM_011484 Theobroma cacao TCM_011484 I 0.427
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.427
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.427
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.427
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.427
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.427
UHOR_08529 Ustilago hordei UHOR_08529 I 0.425
UM06001 Ustilago maydis UM06001 I 0.425