PGSC0003DMG400002988 (Solanum tuberosum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 PGSC0003DMG400002988 T331843_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.737 0.932
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.932
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.705
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.705
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
PGSC0003DMT400007731 Sox 124 167

Links

Other Sox family TFs
Other Solanum tuberosum TFs

532 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
F775_00759 Aegilops tauschii F775_00759 N 0.000
F775_01873 Aegilops tauschii F775_01873 N 0.000
BRADI2G03830 Brachypodium distachyon BRADI2G03830 I 0.000
BRADI2G34600 Brachypodium distachyon BRADI2G34600 N 0.000
evm.TU.supercontig_21.7 Carica papaya evm.TU.supercontig_21.7 N 0.000
Gorai.011G034000 Gossypium raimondii Gorai.011G034000 I 0.000
MLOC_69121 Hordeum vulgare MLOC_69121 N 0.000
LPERR01G03590 Leersia perrieri LPERR01G03590 I 0.000
LPERR05G03980 Leersia perrieri LPERR05G03980 N 0.000
Lus10013917.g Linum usitatissimum Lus10013917.g I 0.000
cassava18812.valid.m1 Manihot esculenta cassava18812.valid.m1 I 0.000
GSMUA_Achr5G29390_001 Musa acuminata GSMUA_Achr5G29390_001 N 0.000
OBART01G03950 Oryza barthii OBART01G03950 N 0.000
OBART05G04450 Oryza barthii OBART05G04450 N 0.000
OB05G14140 Oryza brachyantha OB05G14140 N 0.000
OB01G13800 Oryza brachyantha OB01G13800 N 0.000
ORGLA01G0034700 Oryza glaberrima ORGLA01G0034700 N 0.000
ORGLA05G0041400 Oryza glaberrima ORGLA05G0041400 N 0.000
OGLUM01G04250 Oryza glumaepatula OGLUM01G04250 N 0.000
OGLUM05G04370 Oryza glumaepatula OGLUM05G04370 N 0.000
BGIOSGA002833 Oryza indica BGIOSGA002833 N 0.000
OLONG_015419 Oryza longistaminata OLONG_015419 N 0.000
OMERI01G03850 Oryza meridionalis OMERI01G03850 N 0.000
OMERI05G04410 Oryza meridionalis OMERI05G04410 N 0.000
ONIVA01G04390 Oryza nivara ONIVA01G04390 N 0.000
ONIVA05G04820 Oryza nivara ONIVA05G04820 N 0.000
OPUNC05G04080 Oryza punctata OPUNC05G04080 N 0.000
OPUNC01G03610 Oryza punctata OPUNC01G03610 N 0.000
ORUFI01G04050 Oryza rufipogon ORUFI01G04050 N 0.000
ORUFI05G04670 Oryza rufipogon ORUFI05G04670 N 0.000
OS05G0163900 Oryza sativa OS05G0163900 N 0.000
Pavir.Ea00439 Panicum virgatum Pavir.Ea00439 I 0.000
Pavir.Ca01107 Panicum virgatum Pavir.Ca01107 I 0.000
Pavir.J32610 Panicum virgatum Pavir.J32610 N 0.000
PDK_20s1551661g004 Phoenix dactylifera PDK_20s1551661g004 N 0.000
Si002655m.g Setaria italica Si002655m.g I 0.000
Sb09g004820 Sorghum bicolor Sb09g004820 N 0.000
Sb03g005250 Sorghum bicolor Sb03g005250 N 0.000
Traes_1AS_96F0745A2 Triticum aestivum Traes_1AS_96F0745A2 N 0.000
Traes_3B_2DF1A6E5B Triticum aestivum Traes_3B_2DF1A6E5B N 0.000
TRAES3BF130100030CFD_g Triticum aestivum TRAES3BF130100030CFD_g N 0.000
Traes_1BS_1F372BED3 Triticum aestivum Traes_1BS_1F372BED3 N 0.000
Traes_1DS_CD79239C8 Triticum aestivum Traes_1DS_CD79239C8 N 0.000
TRIUR3_12818 Triticum urartu TRIUR3_12818 N 0.000
TRIUR3_07421 Triticum urartu TRIUR3_07421 N 0.000
TRIUR3_21807 Triticum urartu TRIUR3_21807 N 0.000
GRMZM2G369629 Zea mays GRMZM2G369629 N 0.000
GRMZM2G088443 Zea mays GRMZM2G088443 I 0.000