TCM_011484 (Theobroma cacao)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 TCM_011484 T332825_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.712 0.886
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.712 0.886
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.689 0.750
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.659 0.705
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.659 0.705
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.589 0.636
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
EOY01637 Sox 181 224

Links

Other Sox family TFs
Other Theobroma cacao TFs

518 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.741
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.741
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.741
30174.m009083 Ricinus communis 30174.m009083 I 0.741
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.741
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.741
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.741
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.741
PK13838.1 Cannabis sativa PK13838.1 I 0.741
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.741
Pm030598 Prunus mume Pm030598 I 0.741
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.741
CRC Vitis vinifera VIT_01s0011g00140 I 0.741
Ca_18533 Cicer arietinum Ca_18533 I 0.741
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.741
Cla010397 Citrullus lanatus Cla010397 I 0.741
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.737
Ca_12379 Cicer arietinum Ca_12379 I 0.735
mgf007067m Mimulus guttatus mgf007067m I 0.735
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.730
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.728
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.728
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.728
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.724
MDP0000124879 Malus domestica MDP0000124879 I 0.712
MDP0000291729 Malus domestica MDP0000291729 I 0.712
Bra004364 Brassica rapa Bra004364 I 0.712
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.712
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.712
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.712
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.712
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.712
CRC Arabidopsis thaliana AT1G69180 D 0.712
Bo6g108630 Brassica oleracea Bo6g108630 I 0.712
mgf001016m Mimulus guttatus mgf001016m I 0.709
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.709
MDP0000171878 Malus domestica MDP0000171878 I 0.707
OS03G0215200 Oryza sativa OS03G0215200 I 0.702
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.702
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.702
OB03G18700 Oryza brachyantha OB03G18700 I 0.702
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.702
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.702
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.702
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.702
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.702
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.702
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.702
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.702
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.702
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.702
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.702
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.702
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.702
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.702
OBART03G08320 Oryza barthii OBART03G08320 I 0.702
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.702
Si037608m.g Setaria italica Si037608m.g I 0.702
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.702
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.702
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.702
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.702
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.696
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.696
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.696
Bo8g055830 Brassica oleracea Bo8g055830 I 0.695
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.691
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.689
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.689
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.689
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.689
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.689
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.689
Cla008752 Citrullus lanatus Cla008752 I 0.689
Pm001547 Prunus mume Pm001547 I 0.689
YAB1 Oryza sativa OS07G0160100 I 0.689
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.689
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.689
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.689
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.689
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.689
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.689
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.689
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.689
YAB2 Arabidopsis thaliana AT1G08465 I 0.689
Si030811m.g Setaria italica Si030811m.g I 0.689
29854.m001136 Ricinus communis 29854.m001136 I 0.689
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.689
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.689
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.689
YAB3 Arabidopsis thaliana AT4G00180 I 0.689
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.689
YAB1 Arabidopsis thaliana AT2G45190 D 0.689
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.689
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.689
Ca_07101 Cicer arietinum Ca_07101 I 0.689
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.689
Bo8g112450 Brassica oleracea Bo8g112450 I 0.689
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.689
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.689
mgf019496m Mimulus guttatus mgf019496m I 0.689
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.689
OB07G12810 Oryza brachyantha OB07G12810 I 0.689
mgf009982m Mimulus guttatus mgf009982m I 0.689
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.689
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.689
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.689
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.689
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.689
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.689
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.689
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.689
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.689
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.689
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.689
Bo6g073320 Brassica oleracea Bo6g073320 I 0.689
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.689
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.689
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.689
TCM_041175 Theobroma cacao TCM_041175 I 0.689
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.689
Bo4g195410 Brassica oleracea Bo4g195410 I 0.689
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.689
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.689
Bo5g009010 Brassica oleracea Bo5g009010 I 0.689
MDP0000252640 Malus domestica MDP0000252640 I 0.689
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.689
Bra018624 Brassica rapa Bra018624 I 0.689
Bra030728 Brassica rapa Bra030728 I 0.689
Bra003309 Brassica rapa Bra003309 I 0.689
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.689
Bo9g001130 Brassica oleracea Bo9g001130 I 0.689
Bra000378 Brassica rapa Bra000378 I 0.689
Bra031629 Brassica rapa Bra031629 I 0.689
Bra037320 Brassica rapa Bra037320 I 0.689
MDP0000331808 Malus domestica MDP0000331808 I 0.689
AFO Arabidopsis lyrata scaffold_403460.1 I 0.689
MDP0000366291 Malus domestica MDP0000366291 I 0.689
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.689
Bra040322 Brassica rapa Bra040322 I 0.689
MDP0000500810 Malus domestica MDP0000500810 I 0.689
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.689
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.689
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.689
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.689
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.689
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.689
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.689
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.689
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.689
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.689
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.689
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.689
PK06964.1 Cannabis sativa PK06964.1 I 0.689
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.689
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.689
Bo3g037630 Brassica oleracea Bo3g037630 I 0.689
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.689
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.689
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.689
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.686
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.685
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.683
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.683
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.683
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.683
Si023308m.g Setaria italica Si023308m.g I 0.683
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.683
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.683
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.683
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.683
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.683
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.683
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.683
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.683
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.683
YAB2 Oryza sativa OS03G0650000 I 0.683
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.683
YAB6 Oryza sativa OS12G0621100 I 0.683
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.683
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.683
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.683
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.683
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.683
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.683
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.683
Si037789m.g Setaria italica Si037789m.g I 0.683
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.683
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.683
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.683
OB03G35470 Oryza brachyantha OB03G35470 I 0.683
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.683
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.683
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.683
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.683
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.683
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.683
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.683
OB12G26050 Oryza brachyantha OB12G26050 I 0.683
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.683
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.683
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.683
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.683
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.683
OBART12G19190 Oryza barthii OBART12G19190 I 0.683
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.683
OBART03G27740 Oryza barthii OBART03G27740 I 0.683
F775_28710 Aegilops tauschii F775_28710 I 0.683
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.683
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.679
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.679
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.679
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.678
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.673
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.672
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.669
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.666
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.666
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.666
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.665
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.663
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.663
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.662
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.662
INO Vitis vinifera VIT_01s0127g00330 I 0.662
Si036788m.g Setaria italica Si036788m.g I 0.660
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.660
TCM_016030 Theobroma cacao TCM_016030 I 0.660
TCM_005549 Theobroma cacao TCM_005549 I 0.660
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.660
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.660
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.660
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.660
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.660
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.660
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.660
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.660
28200.m000191 Ricinus communis 28200.m000191 I 0.660
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.660
Pm017846 Prunus mume Pm017846 I 0.660
Ca_25981 Cicer arietinum Ca_25981 I 0.660
MDP0000298333 Malus domestica MDP0000298333 I 0.660
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.660
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.660
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.660
MDP0000192940 Malus domestica MDP0000192940 I 0.660
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.660
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.660
Pm023555 Prunus mume Pm023555 I 0.660
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.660
Cla011745 Citrullus lanatus Cla011745 I 0.660
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.660
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.660
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.660
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.660
mgf003166m Mimulus guttatus mgf003166m I 0.660
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.660
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.660
mgf011463m Mimulus guttatus mgf011463m I 0.660
mgf015806m Mimulus guttatus mgf015806m I 0.660
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.660
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.660
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.660
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.660
30174.m008839 Ricinus communis 30174.m008839 I 0.660
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.660
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.660
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.660
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.660
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.660
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.660
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.660
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.660
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.660
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.660
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.660
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.660
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.660
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.660
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.660
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.660
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.660
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.660
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.660
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.660
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.660
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.660
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.660
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.660
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.660
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.660
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.660
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.660
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.660
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.660
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.660
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.660
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.660
Si018146m.g Setaria italica Si018146m.g I 0.660
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.660
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.660
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.660
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.660
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.660
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.660
OB02G33040 Oryza brachyantha OB02G33040 I 0.660
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.660
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.660
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.660
OBART10G15260 Oryza barthii OBART10G15260 I 0.660
OBART04G20010 Oryza barthii OBART04G20010 I 0.660
OB04G27010 Oryza brachyantha OB04G27010 I 0.660
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.660
OBART02G25670 Oryza barthii OBART02G25670 I 0.660
YAB4 Oryza sativa OS02G0643200 I 0.660
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.660
F775_25525 Aegilops tauschii F775_25525 I 0.660
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.660
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.660
F775_27799 Aegilops tauschii F775_27799 I 0.660
YAB5 Oryza sativa OS04G0536300 I 0.660
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.660
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.660
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.660
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.660
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.660
Si010859m.g Setaria italica Si010859m.g I 0.660
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.660
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.660
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.660
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.660
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.660
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.660
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.660
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.660
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.660
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.660
YAB3 Oryza sativa OS10G0508300 I 0.660
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.660
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.660
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.660
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.659
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.659
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.659
mgf015972m Mimulus guttatus mgf015972m I 0.659
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.659
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.659
YAB5 Arabidopsis thaliana AT2G26580 D 0.659
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.659
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.659
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.659
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.659
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.659
Bo3g041840 Brassica oleracea Bo3g041840 I 0.659
Bra000538 Brassica rapa Bra000538 I 0.659
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.659
PK09461.1 Cannabis sativa PK09461.1 I 0.659
MDP0000255415 Malus domestica MDP0000255415 I 0.659
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.659
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.659
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.659
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.659
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.659
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.659
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.659
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.659
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.659
mgf010765m Mimulus guttatus mgf010765m I 0.659
Pm027559 Prunus mume Pm027559 I 0.659
Cla016962 Citrullus lanatus Cla016962 I 0.659
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.659
29927.m000626 Ricinus communis 29927.m000626 I 0.659
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.659
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.659
Cla012424 Citrullus lanatus Cla012424 I 0.659
TCM_038105 Theobroma cacao TCM_038105 I 0.659
Ca_06681 Cicer arietinum Ca_06681 I 0.659
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.659
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.659
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.659
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.659
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.659
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.659
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.659
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.659
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.659
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.659
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.657
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.654
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.653
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.653
TCM_031868 Theobroma cacao TCM_031868 I 0.653
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.651
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.649
Cla005767 Citrullus lanatus Cla005767 I 0.645
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.636
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.633
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.633
Pm006709 Prunus mume Pm006709 I 0.633
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.633
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.633
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.633
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.633
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.633
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.633
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.633
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.633
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.625
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.625
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.625
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.625
MDP0000263713 Malus domestica MDP0000263713 I 0.625
MDP0000126221 Malus domestica MDP0000126221 I 0.625
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.618
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.613
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.613
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.611
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.611
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.611
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.611
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.609
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.604
Ca_21472 Cicer arietinum Ca_21472 I 0.596
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.595
Cla000824 Citrullus lanatus Cla000824 I 0.595
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.595
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.594
INO Arabidopsis thaliana AT1G23420 D 0.589
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.589
Bra012373 Brassica rapa Bra012373 I 0.589
Bra024599 Brassica rapa Bra024599 I 0.589
Bo7g056180 Brassica oleracea Bo7g056180 I 0.589
Bo5g039580 Brassica oleracea Bo5g039580 I 0.589
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.589
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.589
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.589
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.573
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.567
OB07G25220 Oryza brachyantha OB07G25220 I 0.567
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.567
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.567
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.567
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.563
mgf023167m Mimulus guttatus mgf023167m I 0.563
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.561
Cla010239 Citrullus lanatus Cla010239 I 0.560
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.557
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.552
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.551
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.547
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.540
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.537
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.531
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.523
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
29631.m001046 Ricinus communis 29631.m001046 I 0.514
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.512
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.512
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.509
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.507
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.506
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.500
Moror_16065 Moniliophthora roreri Moror_16065 I 0.485
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.470
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.468
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.463
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.462
CND03770 Cryptococcus neoformans CND03770 I 0.460
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.460
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.453
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.453
THITE_22048 Thielavia terrestris THITE_22048 I 0.451
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.449
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.449
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.443
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.440
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
PV09_07652 Verruconis gallopava PV09_07652 I 0.439
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.438
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.433
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
Si007288m.g Setaria italica Si007288m.g I 0.433
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.433
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.433
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
UM06001 Ustilago maydis UM06001 I 0.430
sr16632 Sporisorium reilianum sr16632 I 0.430
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.426
TRIVIDRAFT_16124 Trichoderma virens TRIVIDRAFT_16124 N 0.421
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GB50764 Apis mellifera GB50764 I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
MDOA001488 Musca domestica MDOA001488 I 0.420
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
UV8b_7580 Ustilaginoidea virens UV8b_7580 N 0.417
KGM_20190 Danaus plexippus KGM_20190 I 0.416
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415