TCM_016030 (Theobroma cacao)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 TCM_016030 T332827_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.678 0.955
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.644 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.644 0.886
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
EOY24425 Sox 127 170

Links

Other Sox family TFs
Other Theobroma cacao TFs

521 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.741
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.741
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.741
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.741
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.741
F775_27799 Aegilops tauschii F775_27799 I 0.741
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.741
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.741
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.741
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.741
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.741
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.741
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.741
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.741
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.741
Si018146m.g Setaria italica Si018146m.g I 0.741
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.741
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.741
YAB5 Oryza sativa OS04G0536300 I 0.737
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.737
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.737
Si010859m.g Setaria italica Si010859m.g I 0.737
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.737
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.737
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.737
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.737
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.737
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.737
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.737
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.737
OB04G27010 Oryza brachyantha OB04G27010 I 0.737
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.737
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.737
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.737
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.737
OBART04G20010 Oryza barthii OBART04G20010 I 0.737
F775_25525 Aegilops tauschii F775_25525 I 0.737
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.737
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.737
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.737
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.737
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.730
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.712
mgf009982m Mimulus guttatus mgf009982m I 0.708
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.708
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.708
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.707
mgf011463m Mimulus guttatus mgf011463m I 0.707
OB02G33040 Oryza brachyantha OB02G33040 I 0.707
OBART10G15260 Oryza barthii OBART10G15260 I 0.707
OBART02G25670 Oryza barthii OBART02G25670 I 0.707
mgf015806m Mimulus guttatus mgf015806m I 0.707
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.707
mgf003166m Mimulus guttatus mgf003166m I 0.707
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.707
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.707
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.707
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.707
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.707
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.707
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.707
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.707
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.707
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.707
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.707
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.707
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.707
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.707
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.707
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.707
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.707
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.707
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.707
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.707
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.707
Ca_25981 Cicer arietinum Ca_25981 I 0.707
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.707
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.707
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.707
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.707
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.707
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.707
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.707
TCM_005549 Theobroma cacao TCM_005549 I 0.707
Si036788m.g Setaria italica Si036788m.g I 0.707
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.707
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.707
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.707
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.707
Pm017846 Prunus mume Pm017846 I 0.707
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.707
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.707
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.707
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.707
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.707
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.707
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.707
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.707
YAB3 Oryza sativa OS10G0508300 I 0.707
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.707
28200.m000191 Ricinus communis 28200.m000191 I 0.707
YAB4 Oryza sativa OS02G0643200 I 0.707
30174.m008839 Ricinus communis 30174.m008839 I 0.707
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.707
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.707
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.707
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.707
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.707
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.707
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.707
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.707
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.702
Pm023555 Prunus mume Pm023555 I 0.702
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.702
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.702
Cla011745 Citrullus lanatus Cla011745 I 0.702
MDP0000192940 Malus domestica MDP0000192940 I 0.702
MDP0000298333 Malus domestica MDP0000298333 I 0.702
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.702
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.702
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.701
MDP0000291729 Malus domestica MDP0000291729 I 0.689
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.689
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.689
MDP0000124879 Malus domestica MDP0000124879 I 0.689
Bra004364 Brassica rapa Bra004364 I 0.689
Bo6g108630 Brassica oleracea Bo6g108630 I 0.689
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.689
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.689
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.689
CRC Arabidopsis thaliana AT1G69180 D 0.689
MDP0000171878 Malus domestica MDP0000171878 I 0.683
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.681
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.678
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.678
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.678
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.678
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.678
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.678
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.678
MDP0000366291 Malus domestica MDP0000366291 I 0.678
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.678
YAB1 Arabidopsis thaliana AT2G45190 D 0.678
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.678
Bra040322 Brassica rapa Bra040322 I 0.678
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.678
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.678
Bra037320 Brassica rapa Bra037320 I 0.678
Bo6g073320 Brassica oleracea Bo6g073320 I 0.678
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.678
Bo8g112450 Brassica oleracea Bo8g112450 I 0.678
Bo5g009010 Brassica oleracea Bo5g009010 I 0.678
Cla016962 Citrullus lanatus Cla016962 I 0.678
Bo3g037630 Brassica oleracea Bo3g037630 I 0.678
YAB3 Arabidopsis thaliana AT4G00180 I 0.678
Bo4g195410 Brassica oleracea Bo4g195410 I 0.678
Bo9g001130 Brassica oleracea Bo9g001130 I 0.678
Bra000378 Brassica rapa Bra000378 I 0.678
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.678
Bra030728 Brassica rapa Bra030728 I 0.678
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.678
Bra018624 Brassica rapa Bra018624 I 0.678
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.678
Bra003309 Brassica rapa Bra003309 I 0.678
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.678
AFO Arabidopsis lyrata scaffold_403460.1 I 0.678
Bra031629 Brassica rapa Bra031629 I 0.678
MDP0000500810 Malus domestica MDP0000500810 I 0.678
INO Vitis vinifera VIT_01s0127g00330 I 0.675
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.674
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.674
MDP0000252640 Malus domestica MDP0000252640 I 0.674
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.674
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.674
PK06964.1 Cannabis sativa PK06964.1 I 0.674
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.674
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.674
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.674
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.674
Cla008752 Citrullus lanatus Cla008752 I 0.674
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.674
YAB1 Oryza sativa OS07G0160100 I 0.674
TCM_041175 Theobroma cacao TCM_041175 I 0.674
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.674
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.674
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.674
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.674
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.674
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.674
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.674
Si030811m.g Setaria italica Si030811m.g I 0.674
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.674
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.674
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.674
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.674
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.674
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.674
Pm001547 Prunus mume Pm001547 I 0.674
Ca_07101 Cicer arietinum Ca_07101 I 0.674
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.674
MDP0000331808 Malus domestica MDP0000331808 I 0.674
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.674
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.674
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.674
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.674
mgf019496m Mimulus guttatus mgf019496m I 0.674
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.674
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.674
OB07G12810 Oryza brachyantha OB07G12810 I 0.674
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.674
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.674
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.674
YAB2 Arabidopsis thaliana AT1G08465 I 0.674
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.674
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.674
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.674
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.674
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.674
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.674
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.674
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.674
29854.m001136 Ricinus communis 29854.m001136 I 0.674
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.674
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.673
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.672
Bo8g055830 Brassica oleracea Bo8g055830 I 0.672
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.672
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.668
Si023308m.g Setaria italica Si023308m.g I 0.668
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.668
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.668
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.668
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.668
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.668
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.668
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.668
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.668
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.668
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.668
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.668
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.668
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.668
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.668
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.668
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.668
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.668
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.668
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.668
Si037789m.g Setaria italica Si037789m.g I 0.668
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.668
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.668
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.668
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.668
YAB2 Oryza sativa OS03G0650000 I 0.668
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.668
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.668
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.668
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.668
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.668
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.668
F775_28710 Aegilops tauschii F775_28710 I 0.668
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.668
YAB6 Oryza sativa OS12G0621100 I 0.668
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.668
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.668
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.668
OBART12G19190 Oryza barthii OBART12G19190 I 0.668
OB12G26050 Oryza brachyantha OB12G26050 I 0.668
OB03G35470 Oryza brachyantha OB03G35470 I 0.668
OBART03G27740 Oryza barthii OBART03G27740 I 0.668
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.668
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.667
TCM_031868 Theobroma cacao TCM_031868 I 0.666
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.666
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.664
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.664
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.663
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.663
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.661
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.661
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.661
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.660
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.660
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.660
Ca_18533 Cicer arietinum Ca_18533 I 0.660
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.660
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.660
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.660
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.660
30174.m009083 Ricinus communis 30174.m009083 I 0.660
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.660
Ca_12379 Cicer arietinum Ca_12379 I 0.660
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.660
Cla010397 Citrullus lanatus Cla010397 I 0.660
CRC Vitis vinifera VIT_01s0011g00140 I 0.660
Pm030598 Prunus mume Pm030598 I 0.660
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.660
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.660
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.660
PK13838.1 Cannabis sativa PK13838.1 I 0.660
TCM_011484 Theobroma cacao TCM_011484 I 0.660
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.659
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.657
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.654
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.654
mgf007067m Mimulus guttatus mgf007067m I 0.654
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.651
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.651
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.649
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.647
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.646
Pm006709 Prunus mume Pm006709 I 0.645
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.645
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.645
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.644
Bo3g041840 Brassica oleracea Bo3g041840 I 0.644
29927.m000626 Ricinus communis 29927.m000626 I 0.644
Pm027559 Prunus mume Pm027559 I 0.644
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.644
YAB5 Arabidopsis thaliana AT2G26580 D 0.644
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.644
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.644
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.644
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.644
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.644
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.644
mgf010765m Mimulus guttatus mgf010765m I 0.644
mgf015972m Mimulus guttatus mgf015972m I 0.644
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.644
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.644
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.644
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.644
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.644
MDP0000255415 Malus domestica MDP0000255415 I 0.644
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.644
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.644
Cla012424 Citrullus lanatus Cla012424 I 0.644
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.644
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.644
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.644
Bra000538 Brassica rapa Bra000538 I 0.644
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.644
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.644
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.644
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.644
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.644
PK09461.1 Cannabis sativa PK09461.1 I 0.644
TCM_038105 Theobroma cacao TCM_038105 I 0.644
Ca_06681 Cicer arietinum Ca_06681 I 0.644
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.644
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.644
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.644
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.644
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.644
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.641
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.641
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.640
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.638
MDP0000263713 Malus domestica MDP0000263713 I 0.637
MDP0000126221 Malus domestica MDP0000126221 I 0.637
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.634
Ca_21472 Cicer arietinum Ca_21472 I 0.632
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.631
Cla010239 Citrullus lanatus Cla010239 I 0.630
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.628
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.628
OBART03G08320 Oryza barthii OBART03G08320 I 0.628
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.628
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.628
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.628
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.628
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.628
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.628
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.628
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.628
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.628
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.628
OB03G18700 Oryza brachyantha OB03G18700 I 0.628
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.628
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.628
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.628
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.628
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.628
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.628
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.628
Si037608m.g Setaria italica Si037608m.g I 0.628
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.628
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.628
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.628
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.628
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.628
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.628
OS03G0215200 Oryza sativa OS03G0215200 I 0.628
mgf001016m Mimulus guttatus mgf001016m I 0.628
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.624
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.623
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.622
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.621
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.621
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.621
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.621
Cla005767 Citrullus lanatus Cla005767 I 0.618
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.611
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.611
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.611
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.611
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.611
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.611
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.611
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.611
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.611
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.610
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.607
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.603
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.603
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.603
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.603
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.601
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.598
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.598
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.597
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.595
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.594
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.585
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.585
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.585
OB07G25220 Oryza brachyantha OB07G25220 I 0.580
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.580
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.579
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.579
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.579
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.577
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.577
mgf023167m Mimulus guttatus mgf023167m I 0.575
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.575
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.573
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.573
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.573
Cla000824 Citrullus lanatus Cla000824 I 0.573
Bra012373 Brassica rapa Bra012373 I 0.567
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.567
Bo7g056180 Brassica oleracea Bo7g056180 I 0.567
Bra024599 Brassica rapa Bra024599 I 0.567
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.567
INO Arabidopsis thaliana AT1G23420 D 0.567
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.567
Bo5g039580 Brassica oleracea Bo5g039580 I 0.567
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.565
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.564
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.553
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.542
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.542
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.539
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.538
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.535
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.533
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
Moror_16065 Moniliophthora roreri Moror_16065 I 0.516
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.509
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.496
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
29631.m001046 Ricinus communis 29631.m001046 I 0.486
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.479
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
CND03770 Cryptococcus neoformans CND03770 I 0.467
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
UHOR_08529 Ustilago hordei UHOR_08529 I 0.464
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.456
PEQ_0000291001 Parascaris equorum PEQ_0000291001 I 0.453
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.448
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.441
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.440
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.437
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.437
GB50764 Apis mellifera GB50764 I 0.433
M407DRAFT_28999 Tulasnella calospora M407DRAFT_28999 N 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
TOX2 Sorex araneus ENSSARG00000001080 N 0.430
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.430
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.430
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
SCHCODRAFT_73620 Schizophyllum commune SCHCODRAFT_73620 N 0.427
GE25578 Drosophila yakuba FBgn0242642 I 0.427
MDOA001488 Musca domestica MDOA001488 I 0.427
GK13574 Drosophila willistoni FBgn0215582 I 0.427
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.427
GH18160 Drosophila grimshawi FBgn0125628 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.427
scaffold_600397.1 Arabidopsis lyrata scaffold_600397.1 I 0.426
M404DRAFT_998370 Pisolithus tinctorius M404DRAFT_998370 N 0.425
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.425
Hsal_06265--XP_624018.2_APIME Harpegnathos saltator Hsal_06265--XP_624018.2_APIME N 0.424
ENSTGUG00000014902 Taeniopygia guttata ENSTGUG00000014902 N 0.424
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.422
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
TELCIR_25179 Teladorsagia circumcincta TELCIR_25179 N 0.420
HPBE_0002300401 Heligmosomoides bakeri HPBE_0002300401 N 0.420
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.420
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.419
0600010013 Ostreococcus tauri 0600010013 I 0.417
KGM_20190 Danaus plexippus KGM_20190 I 0.416
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
NV13812 Nasonia vitripennis NV13812 I 0.416
MCINX012524 Melitaea cinxia MCINX012524 I 0.416
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.416
E5Q_04235 Mixia osmundae E5Q_04235 I 0.416
E5Q_04236 Mixia osmundae E5Q_04236 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.416