YAB5 (Vitis vinifera)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 VIT_11s0016g05590 T333238_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.741 1.000
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.741 1.000
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.707 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.630 0.659
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.630 0.659
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
VIT_11s0016g05590.t01 Sox 110 153

Links

Other Sox family TFs
Other Vitis vinifera TFs

531 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Thhalv10000419m.g Eutrema salsugineum Thhalv10000419m.g N 0.000
Thhalv10000526m.g Eutrema salsugineum Thhalv10000526m.g N 0.000
Thhalv10000561m.g Eutrema salsugineum Thhalv10000561m.g N 0.000
Thhalv10000593m.g Eutrema salsugineum Thhalv10000593m.g N 0.000
Thhalv10000672m.g Eutrema salsugineum Thhalv10000672m.g N 0.000
Thhalv10000694m.g Eutrema salsugineum Thhalv10000694m.g N 0.000
Thhalv10000718m.g Eutrema salsugineum Thhalv10000718m.g N 0.000
Thhalv10027108m.g Eutrema salsugineum Thhalv10027108m.g N 0.000