Ca_12379 (Cicer arietinum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Ca_12379 T333597_2.00 GigaDB (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.706 0.837
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.706 0.837
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.689 0.767
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.659 0.721
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.659 0.721
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.589 0.628
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Ca_12379 Sox 122 164

Links

Other Sox family TFs
Other Cicer arietinum TFs

521 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
28200.m000191 Ricinus communis 28200.m000191 I 0.660
29631.m001046 Ricinus communis 29631.m001046 I 0.514
29854.m001136 Ricinus communis 29854.m001136 I 0.689
29927.m000626 Ricinus communis 29927.m000626 I 0.659
30174.m008839 Ricinus communis 30174.m008839 I 0.660
30174.m009083 Ricinus communis 30174.m009083 I 0.735
ACEP12759 Atta cephalotes ACEP12759 I 0.420
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.438
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.506
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.689
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.724
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.689
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.689
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.636
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.651
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.689
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.659
YAB2 Arabidopsis thaliana AT1G08465 I 0.689
INO Arabidopsis thaliana AT1G23420 D 0.589
CRC Arabidopsis thaliana AT1G69180 D 0.706
YAB5 Arabidopsis thaliana AT2G26580 D 0.659
YAB1 Arabidopsis thaliana AT2G45190 D 0.689
YAB3 Arabidopsis thaliana AT4G00180 I 0.689
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.537
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.702
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.683
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.660
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.567
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.683
Bo3g037630 Brassica oleracea Bo3g037630 I 0.689
Bo3g041840 Brassica oleracea Bo3g041840 I 0.659
Bo4g195410 Brassica oleracea Bo4g195410 I 0.689
Bo5g009010 Brassica oleracea Bo5g009010 I 0.689
Bo5g039580 Brassica oleracea Bo5g039580 I 0.589
Bo6g073320 Brassica oleracea Bo6g073320 I 0.689
Bo6g108630 Brassica oleracea Bo6g108630 I 0.706
Bo7g056180 Brassica oleracea Bo7g056180 I 0.589
Bo8g055830 Brassica oleracea Bo8g055830 I 0.695
Bo8g112450 Brassica oleracea Bo8g112450 I 0.689
Bo9g001130 Brassica oleracea Bo9g001130 I 0.689
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.706
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.589
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.689
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.659
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.689
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.689
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.449
Bra000378 Brassica rapa Bra000378 I 0.689
Bra000538 Brassica rapa Bra000538 I 0.659
Bra003309 Brassica rapa Bra003309 I 0.689
Bra004364 Brassica rapa Bra004364 I 0.706
Bra012373 Brassica rapa Bra012373 I 0.589
Bra018624 Brassica rapa Bra018624 I 0.689
Bra024599 Brassica rapa Bra024599 I 0.589
Bra030728 Brassica rapa Bra030728 I 0.689
Bra031629 Brassica rapa Bra031629 I 0.689
Bra037320 Brassica rapa Bra037320 I 0.689
Bra040322 Brassica rapa Bra040322 I 0.689
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.683
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.433
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.678
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.702
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.660
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.660
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.683
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.660
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.689
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.706
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.633
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.659
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.689
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.689
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.689
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.689
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.633
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.706
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.689
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.659
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.735
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.659
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.659
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.660
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.654
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.633
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.618
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.660
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.659
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.689
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.735
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.689
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.625
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.660
Ca_06681 Cicer arietinum Ca_06681 I 0.659
Ca_07101 Cicer arietinum Ca_07101 I 0.689
Ca_18533 Cicer arietinum Ca_18533 I 0.735
Ca_21472 Cicer arietinum Ca_21472 I 0.596
Ca_25981 Cicer arietinum Ca_25981 I 0.660
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.625
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.657
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.659
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.660
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.660
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.689
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.613
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.702
Cla000824 Citrullus lanatus Cla000824 I 0.595
Cla005767 Citrullus lanatus Cla005767 I 0.645
Cla008752 Citrullus lanatus Cla008752 I 0.689
Cla010239 Citrullus lanatus Cla010239 I 0.560
Cla010397 Citrullus lanatus Cla010397 I 0.735
Cla011745 Citrullus lanatus Cla011745 I 0.660
Cla012424 Citrullus lanatus Cla012424 I 0.659
Cla016962 Citrullus lanatus Cla016962 I 0.659
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
CND03770 Cryptococcus neoformans CND03770 I 0.460
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.689
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.659
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.735
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.540
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.659
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.660
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.665
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.595
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.443
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.507
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.512
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.440
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.512
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.735
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.633
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.659
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.689
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.660
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.689
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.561
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.735
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.689
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.689
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.660
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.660
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.659
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.589
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
F775_25525 Aegilops tauschii F775_25525 I 0.660
F775_27799 Aegilops tauschii F775_27799 I 0.660
F775_28710 Aegilops tauschii F775_28710 I 0.683
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.460
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.589
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.689
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.706
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.659
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.689
GB50764 Apis mellifera GB50764 I 0.420
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.689
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.728
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.659
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.660
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.449
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.523
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.551
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.547
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.594
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.735
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.433
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.660
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.735
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.660
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.433
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.604
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.660
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.595
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.689
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.662
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.689
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.689
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.659
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.689
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.659
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.660
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.662
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.659
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.689
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.660
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.653
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.735
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.689
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.552
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.660
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.659
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.653
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.689
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.660
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.573
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.660
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.683
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.660
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.683
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.702
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.702
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.689
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.683
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.683
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.660
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.660
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.433
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.660
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.660
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.685
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.689
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.689
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.689
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.669
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.666
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.611
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.666
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.696
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.659
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.649
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.691
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.611
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.696
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.679
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.689
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.660
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.679
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.666
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.663
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.660
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.663
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.672
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.509
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.426
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.460
KGM_20190 Danaus plexippus KGM_20190 I 0.416
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.660
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.660
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.702
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.683
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.660
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.689
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.611
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.660
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.660
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.633
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.659
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.689
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.633
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.531
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.613
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.689
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.660
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.735
M378DRAFT_228709 Amanita muscaria M378DRAFT_228709 N 0.416
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
MDOA001488 Musca domestica MDOA001488 I 0.420
MDP0000124879 Malus domestica MDP0000124879 I 0.706
MDP0000126221 Malus domestica MDP0000126221 I 0.625
MDP0000171878 Malus domestica MDP0000171878 I 0.700
MDP0000192940 Malus domestica MDP0000192940 I 0.660
MDP0000252640 Malus domestica MDP0000252640 I 0.689
MDP0000255415 Malus domestica MDP0000255415 I 0.659
MDP0000263713 Malus domestica MDP0000263713 I 0.625
MDP0000291729 Malus domestica MDP0000291729 I 0.706
MDP0000298333 Malus domestica MDP0000298333 I 0.660
MDP0000331808 Malus domestica MDP0000331808 I 0.689
MDP0000366291 Malus domestica MDP0000366291 I 0.689
MDP0000500810 Malus domestica MDP0000500810 I 0.689
mgf001016m Mimulus guttatus mgf001016m I 0.702
mgf003166m Mimulus guttatus mgf003166m I 0.660
mgf007067m Mimulus guttatus mgf007067m I 0.729
mgf009982m Mimulus guttatus mgf009982m I 0.689
mgf010765m Mimulus guttatus mgf010765m I 0.659
mgf011463m Mimulus guttatus mgf011463m I 0.660
mgf015806m Mimulus guttatus mgf015806m I 0.660
mgf015972m Mimulus guttatus mgf015972m I 0.659
mgf019496m Mimulus guttatus mgf019496m I 0.689
mgf023167m Mimulus guttatus mgf023167m I 0.563
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.660
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.683
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.660
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.683
Moror_16065 Moniliophthora roreri Moror_16065 I 0.485
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.689
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.660
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.689
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.660
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.659
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.625
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.453
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
OB02G33040 Oryza brachyantha OB02G33040 I 0.660
OB03G18700 Oryza brachyantha OB03G18700 I 0.702
OB03G35470 Oryza brachyantha OB03G35470 I 0.683
OB04G27010 Oryza brachyantha OB04G27010 I 0.660
OB07G12810 Oryza brachyantha OB07G12810 I 0.689
OB07G25220 Oryza brachyantha OB07G25220 I 0.567
OB12G26050 Oryza brachyantha OB12G26050 I 0.683
OBART02G25670 Oryza barthii OBART02G25670 I 0.660
OBART03G08320 Oryza barthii OBART03G08320 I 0.702
OBART03G27740 Oryza barthii OBART03G27740 I 0.683
OBART04G20010 Oryza barthii OBART04G20010 I 0.660
OBART10G15260 Oryza barthii OBART10G15260 I 0.660
OBART12G19190 Oryza barthii OBART12G19190 I 0.683
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.660
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.702
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.683
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.660
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.660
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.683
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.567
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.702
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.683
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.660
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.660
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.702
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.660
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.689
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.567
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.660
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.683
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.683
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.660
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.702
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.683
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.660
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.660
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.660
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.702
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.683
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.689
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.660
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.683
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.660
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.660
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.659
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.689
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.625
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.686
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.660
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.702
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.660
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.567
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.683
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.660
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.702
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.683
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.660
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.689
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.660
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.683
YAB4 Oryza sativa OS02G0643200 I 0.660
OS03G0215200 Oryza sativa OS03G0215200 I 0.702
YAB2 Oryza sativa OS03G0650000 I 0.683
YAB5 Oryza sativa OS04G0536300 I 0.660
YAB1 Oryza sativa OS07G0160100 I 0.689
YAB3 Oryza sativa OS10G0508300 I 0.660
YAB6 Oryza sativa OS12G0621100 I 0.683
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.660
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.660
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.689
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.683
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.683
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.660
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.660
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.683
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.702
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.702
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.660
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.683
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.702
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.609
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.463
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.659
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.689
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.689
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.689
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.660
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.730
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.659
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
PK06964.1 Cannabis sativa PK06964.1 I 0.689
PK09461.1 Cannabis sativa PK09461.1 I 0.659
PK13838.1 Cannabis sativa PK13838.1 I 0.735
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.470
Pm001547 Prunus mume Pm001547 I 0.689
Pm006709 Prunus mume Pm006709 I 0.633
Pm017846 Prunus mume Pm017846 I 0.660
Pm023555 Prunus mume Pm023555 I 0.660
Pm027559 Prunus mume Pm027559 I 0.659
Pm030598 Prunus mume Pm030598 I 0.735
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.660
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.689
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.660
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.660
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.659
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.696
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.673
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.633
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.728
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.660
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.683
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.659
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.660
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.660
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.689
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.659
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.735
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.633
PV09_07652 Verruconis gallopava PV09_07652 I 0.439
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.462
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.500
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.660
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.659
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.633
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.728
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.702
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.660
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.660
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.683
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.633
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.689
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.660
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.659
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.660
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.660
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.689
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.683
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.660
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.702
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.689
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.660
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.660
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.683
AFO Arabidopsis lyrata scaffold_403460.1 I 0.689
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.468
Si007288m.g Setaria italica Si007288m.g I 0.433
Si010859m.g Setaria italica Si010859m.g I 0.660
Si018146m.g Setaria italica Si018146m.g I 0.660
Si023308m.g Setaria italica Si023308m.g I 0.683
Si030811m.g Setaria italica Si030811m.g I 0.689
Si036788m.g Setaria italica Si036788m.g I 0.660
Si037608m.g Setaria italica Si037608m.g I 0.702
Si037789m.g Setaria italica Si037789m.g I 0.683
SINV12391 Solenopsis invicta SINV12391 I 0.420
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.660
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.563
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.730
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.689
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.659
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.689
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.689
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.659
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.557
sr16632 Sporisorium reilianum sr16632 I 0.430
TCM_005549 Theobroma cacao TCM_005549 I 0.660
TCM_011484 Theobroma cacao TCM_011484 I 0.735
TCM_016030 Theobroma cacao TCM_016030 I 0.660
TCM_031868 Theobroma cacao TCM_031868 I 0.653
TCM_038105 Theobroma cacao TCM_038105 I 0.659
TCM_041175 Theobroma cacao TCM_041175 I 0.689
TELCIR_19210 Teladorsagia circumcincta TELCIR_19210 N 0.415
TELCIR_25179 Teladorsagia circumcincta TELCIR_25179 N 0.421
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.689
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.589
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.689
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.659
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.706
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.689
THITE_22048 Thielavia terrestris THITE_22048 I 0.451
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.660
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.660
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.660
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.611
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.702
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.702
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.702
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.683
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.683
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.683
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.683
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.683
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.683
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.660
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.660
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.660
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.683
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.683
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.660
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.660
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.702
TRIVIDRAFT_16124 Trichoderma virens TRIVIDRAFT_16124 N 0.421
UM06001 Ustilago maydis UM06001 I 0.430
UV8b_7580 Ustilaginoidea virens UV8b_7580 N 0.417
CRC Vitis vinifera VIT_01s0011g00140 I 0.735
INO Vitis vinifera VIT_01s0127g00330 I 0.662
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.660
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.689
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.679
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.659
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.660