Cla011745 (Citrullus lanatus)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Cla011745 T333644_2.00 GigaDB (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.708 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.750
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.750
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.678 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.678 0.886
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.705
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Cla011745 Sox 155 198

Links

Other Sox family TFs
Other Citrullus lanatus TFs

529 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Doc3 Drosophila melanogaster FBgn0035954 D 0.000
Doc2 Drosophila melanogaster FBgn0035956 D 0.000
GK12352 Drosophila willistoni FBgn0214362 I 0.000
AATE019626 Anopheles atroparvus AATE019626 I 0.000
AARA007626 Anopheles arabiensis AARA007626 I 0.000
AALB004781 Anopheles albimanus AALB004781 I 0.000
LCUP005947 Lucilia cuprina LCUP005947 I 0.000
LCUP005946 Lucilia cuprina LCUP005946 I 0.000
LCUP005945 Lucilia cuprina LCUP005945 I 0.000
GK12279 Drosophila willistoni FBgn0214289 I 0.000
MESCA005219 Megaselia scalaris MESCA005219 I 0.000
GE21264 Drosophila yakuba FBgn0238533 I 0.000
GE20800 Drosophila yakuba FBgn0238094 I 0.000
GE20799 Drosophila yakuba FBgn0238093 I 0.000
GK12353 Drosophila willistoni FBgn0214363 I 0.000
ACHR005948 Anopheles christyi ACHR005948 I 0.000
ACOM024997 Anopheles coluzzii ACOM024997 I 0.000
ACUA013605 Anopheles culicifacies ACUA013605 I 0.000
MDOA015287 Musca domestica MDOA015287 I 0.000
MDOA006037 Musca domestica MDOA006037 I 0.000
MDOA003812 Musca domestica MDOA003812 I 0.000
ASTEI02809 Anopheles stephensi ASTEI02809 I 0.000
ASIS012852 Anopheles sinensis ASIS012852 I 0.000
AQUA010990 Anopheles quadriannulatus AQUA010990 I 0.000
AMIN011562 Anopheles minimus AMIN011562 I 0.000
AMEM015129 Anopheles merus AMEM015129 I 0.000
AMEC016175 Anopheles melas AMEC016175 I 0.000
AFUN010103 Anopheles funestus AFUN010103 I 0.000
AFAF003219 Anopheles farauti AFAF003219 I 0.000
AEPI008783 Anopheles epiroticus AEPI008783 I 0.000
ADIR008855 Anopheles dirus ADIR008855 I 0.000
GJ11697 Drosophila virilis FBgn0198951 I 0.000
GJ11695 Drosophila virilis FBgn0198949 I 0.000
GD14149 Drosophila simulans FBgn0185837 I 0.000
GG14368 Drosophila erecta FBgn0106627 I 0.000
GF24375 Drosophila ananassae FBgn0101369 I 0.000
GF24374 Drosophila ananassae FBgn0101368 I 0.000
GF10130 Drosophila ananassae FBgn0087171 I 0.000
GA18721 Drosophila pseudoobscura FBgn0078721 I 0.000
GA18682 Drosophila pseudoobscura FBgn0078682 I 0.000
GA18655 Drosophila pseudoobscura FBgn0078655 I 0.000
CpipJ_CPIJ004922 Culex pipiens CpipJ_CPIJ004922 I 0.000
Doc1 Drosophila melanogaster FBgn0028789 I 0.000
AGAP005896 Anopheles gambiae AGAP005896 I 0.000
AGAP005895 Anopheles gambiae AGAP005895 I 0.000
ADAC005019 Anopheles darlingi ADAC005019 I 0.000
AAEL013504 Aedes aegypti AAEL013504 I 0.000
GG14369 Drosophila erecta FBgn0106628 I 0.000
GG15041 Drosophila erecta FBgn0107295 I 0.000
GD14148 Drosophila simulans FBgn0185836 I 0.000
GM25113 Drosophila sechellia FBgn0179974 I 0.000
GM25112 Drosophila sechellia FBgn0179973 I 0.000
GM24895 Drosophila sechellia FBgn0179757 I 0.000
GL15081 Drosophila persimilis FBgn0152685 I 0.000
GL15034 Drosophila persimilis FBgn0152638 I 0.000
GL15033 Drosophila persimilis FBgn0152637 I 0.000
GI13831 Drosophila mojavensis FBgn0136585 I 0.000
GI13829 Drosophila mojavensis FBgn0136583 I 0.000
GI11482 Drosophila mojavensis FBgn0134242 I 0.000
GH16541 Drosophila grimshawi FBgn0124012 I 0.000
GH16540 Drosophila grimshawi FBgn0124011 I 0.000
GH14955 Drosophila grimshawi FBgn0122430 I 0.000
AAEL004174 Aedes aegypti AAEL004174 I 0.000