Pm006709 (Prunus mume)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Pm006709 T333834_2.00 GigaDB (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.640 0.717
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.640 0.717
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.640 0.696
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.629 0.848
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.604 0.565
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.604 0.565
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pm006709 Sox 88 133

Links

Other Sox family TFs
Other Prunus mume TFs

544 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
29584.m000237 Ricinus communis 29584.m000237 I 0.000
29603.m000510 Ricinus communis 29603.m000510 I 0.000
AMTR_s00009p00147970 Amborella trichopoda AMTR_s00009p00147970 I 0.000
AMTR_s00009p00148470 Amborella trichopoda AMTR_s00009p00148470 I 0.000
AMTR_s00021p00185480 Amborella trichopoda AMTR_s00021p00185480 I 0.000
Aquca_034_00377 Aquilegia coerulea Aquca_034_00377 N 0.000
ERF096 Arabidopsis thaliana AT5G43410 D 0.000
BGIOSGA015474 Oryza indica BGIOSGA015474 I 0.000
BGIOSGA029205 Oryza indica BGIOSGA029205 I 0.000
BGIOSGA029206 Oryza indica BGIOSGA029206 I 0.000
BGIOSGA029230 Oryza indica BGIOSGA029230 I 0.000
BGIOSGA031822 Oryza indica BGIOSGA031822 I 0.000
Bo9g059180 Brassica oleracea Bo9g059180 I 0.000
Bostr.26675s0318 Boechera stricta Bostr.26675s0318 I 0.000
Bostr.3148s0125 Boechera stricta Bostr.3148s0125 I 0.000
Bra027493 Brassica rapa Bra027493 I 0.000
BRADI1G75040 Brachypodium distachyon BRADI1G75040 I 0.000
BRADI3G12565 Brachypodium distachyon BRADI3G12565 I 0.000
Cagra.0244s0009 Capsella grandiflora Cagra.0244s0009 I 0.000
Cagra.1671s0052 Capsella grandiflora Cagra.1671s0052 I 0.000
Carubv10011057m.g Capsella rubella Carubv10011057m.g I 0.000
Carubv10028227m.g Capsella rubella Carubv10028227m.g I 0.000
cassava3323.m1 Manihot esculenta cassava3323.m1 I 0.000
cassava38508.m1 Manihot esculenta cassava38508.m1 I 0.000
cassava41615.m1 Manihot esculenta cassava41615.m1 I 0.000
cassava631.valid.m1 Manihot esculenta cassava631.valid.m1 I 0.000
Ciclev10006784m.g Citrus clementina Ciclev10006784m.g I 0.000
Ciclev10007133m.g Citrus clementina Ciclev10007133m.g I 0.000
Cla007696 Citrullus lanatus Cla007696 I 0.000
Cla015064 Citrullus lanatus Cla015064 I 0.000
Cla021852 Citrullus lanatus Cla021852 I 0.000
Cucsa.255320 Cucumis sativus Cucsa.255320 I 0.000
Cucsa.383680 Cucumis sativus Cucsa.383680 I 0.000
Eucgr.B01537 Eucalyptus grandis Eucgr.B01537 I 0.000
Eucgr.H03090 Eucalyptus grandis Eucgr.H03090 I 0.000
evm.TU.supercontig_44.74 Carica papaya evm.TU.supercontig_44.74 I 0.000
F775_03520 Aegilops tauschii F775_03520 I 0.000
F775_23071 Aegilops tauschii F775_23071 I 0.000
F775_33015 Aegilops tauschii F775_33015 I 0.000
gene08071-v1.0-hybrid Fragaria vesca gene08071-v1.0-hybrid I 0.000
gene11440-v1.0-hybrid Fragaria vesca gene11440-v1.0-hybrid I 0.000
GLYMA02G00890 Glycine max GLYMA02G00890 I 0.000
GLYMA10G33080 Glycine max GLYMA10G33080 I 0.000
GLYMA20G34550 Glycine max GLYMA20G34550 I 0.000
Gorai.001G176600 Gossypium raimondii Gorai.001G176600 I 0.000
Gorai.005G049200 Gossypium raimondii Gorai.005G049200 I 0.000
Gorai.006G249800 Gossypium raimondii Gorai.006G249800 I 0.000
GRMZM2G060206 Zea mays GRMZM2G060206 I 0.000
GRMZM2G060517 Zea mays GRMZM2G060517 I 0.000
GSMUA_Achr1G15350_001 Musa acuminata GSMUA_Achr1G15350_001 I 0.000
LjSGA_028626.1 Lotus japonicus LjSGA_028626.1 I 0.000
LPERR04G03550 Leersia perrieri LPERR04G03550 I 0.000
LPERR08G20550 Leersia perrieri LPERR08G20550 I 0.000
LPERR09G16370 Leersia perrieri LPERR09G16370 I 0.000
Lus10011831.g Linum usitatissimum Lus10011831.g I 0.000
Lus10021196.g Linum usitatissimum Lus10021196.g I 0.000
mgf018935m Mimulus guttatus mgf018935m I 0.000
OB04G14270 Oryza brachyantha OB04G14270 I 0.000
OB08G30700 Oryza brachyantha OB08G30700 I 0.000
OB09G27120 Oryza brachyantha OB09G27120 I 0.000
OBART04G05450 Oryza barthii OBART04G05450 I 0.000
OBART08G23880 Oryza barthii OBART08G23880 I 0.000
OBART09G20380 Oryza barthii OBART09G20380 I 0.000
OBART10G11630 Oryza barthii OBART10G11630 I 0.000
OGLUM04G04620 Oryza glumaepatula OGLUM04G04620 I 0.000
OGLUM08G25360 Oryza glumaepatula OGLUM08G25360 I 0.000
OGLUM09G21140 Oryza glumaepatula OGLUM09G21140 I 0.000
OGLUM10G11380 Oryza glumaepatula OGLUM10G11380 I 0.000
OLONG_005596 Oryza longistaminata OLONG_005596 I 0.000
OLONG_010226 Oryza longistaminata OLONG_010226 I 0.000
OLONG_027600 Oryza longistaminata OLONG_027600 I 0.000
OMERI03G03710 Oryza meridionalis OMERI03G03710 I 0.000
OMERI08G18690 Oryza meridionalis OMERI08G18690 I 0.000
ONIVA01G39370 Oryza nivara ONIVA01G39370 I 0.000
ONIVA04G03680 Oryza nivara ONIVA04G03680 I 0.000
ONIVA09G01310 Oryza nivara ONIVA09G01310 I 0.000
ONIVA10G10810 Oryza nivara ONIVA10G10810 I 0.000
OPUNC08G21790 Oryza punctata OPUNC08G21790 I 0.000
OPUNC09G18680 Oryza punctata OPUNC09G18680 I 0.000
OPUNC10G09910 Oryza punctata OPUNC10G09910 I 0.000
orange1.1g047241m.g Citrus sinensis orange1.1g047241m.g I 0.000
orange1.1g048608m.g Citrus sinensis orange1.1g048608m.g I 0.000
ORGLA04G0041100 Oryza glaberrima ORGLA04G0041100 I 0.000
ORGLA08G0192600 Oryza glaberrima ORGLA08G0192600 I 0.000
ORGLA09G0166700 Oryza glaberrima ORGLA09G0166700 I 0.000
ORGLA10G0102500 Oryza glaberrima ORGLA10G0102500 I 0.000
ORUFI04G06330 Oryza rufipogon ORUFI04G06330 I 0.000
ORUFI08G26360 Oryza rufipogon ORUFI08G26360 I 0.000
ORUFI09G22030 Oryza rufipogon ORUFI09G22030 I 0.000
ORUFI10G12140 Oryza rufipogon ORUFI10G12140 I 0.000
OS04G0257500 Oryza sativa OS04G0257500 I 0.000
OS09G0571700 Oryza sativa OS09G0571700 I 0.000
Pavir.Bb01308 Panicum virgatum Pavir.Bb01308 I 0.000
Pavir.Fa00010 Panicum virgatum Pavir.Fa00010 I 0.000
Pavir.Fb02184 Panicum virgatum Pavir.Fb02184 I 0.000
PGSC0003DMG400017233 Solanum tuberosum PGSC0003DMG400017233 I 0.000
PGSC0003DMG400045092 Solanum tuberosum PGSC0003DMG400045092 I 0.000
POPTR_0008s16590 Populus trichocarpa POPTR_0008s16590 I 0.000
POPTR_0010s08310 Populus trichocarpa POPTR_0010s08310 I 0.000
POPTR_0010s08330 Populus trichocarpa POPTR_0010s08330 I 0.000
SapurV1A.0006s0870 Salix purpurea SapurV1A.0006s0870 I 0.000
SapurV1A.0007s0960 Salix purpurea SapurV1A.0007s0960 I 0.000
SapurV1A.0021s0990 Salix purpurea SapurV1A.0021s0990 I 0.000
SapurV1A.0021s1000 Salix purpurea SapurV1A.0021s1000 I 0.000
SapurV1A.0292s0010 Salix purpurea SapurV1A.0292s0010 I 0.000
SapurV1A.0292s0020 Salix purpurea SapurV1A.0292s0020 I 0.000
Sb07g023803 Sorghum bicolor Sb07g023803 I 0.000
ATERF14 Arabidopsis lyrata scaffold_100393.1 I 0.000
scaffold_800707.1 Arabidopsis lyrata scaffold_800707.1 I 0.000
Si011941m.g Setaria italica Si011941m.g I 0.000
Si032391m.g Setaria italica Si032391m.g I 0.000
Si040039m.g Setaria italica Si040039m.g I 0.000
Solyc09g089910.1 Solanum lycopersicum Solyc09g089910.1 I 0.000
Solyc11g006050.1 Solanum lycopersicum Solyc11g006050.1 I 0.000
TCM_020869 Theobroma cacao TCM_020869 I 0.000
Thhalv10003355m.g Eutrema salsugineum Thhalv10003355m.g I 0.000
Thhalv10009418m.g Eutrema salsugineum Thhalv10009418m.g I 0.000
Traes_4AS_FA4BBDBF9 Triticum aestivum Traes_4AS_FA4BBDBF9 I 0.000
Traes_4BS_180379032 Triticum aestivum Traes_4BS_180379032 I 0.000
Traes_4DS_AB2BEFAB3 Triticum aestivum Traes_4DS_AB2BEFAB3 I 0.000
Traes_6BS_4C945B9F1 Triticum aestivum Traes_6BS_4C945B9F1 I 0.000
TRIUR3_22798 Triticum urartu TRIUR3_22798 I 0.000
VIT_07s0005g03200 Vitis vinifera VIT_07s0005g03200 I 0.000
VIT_07s0005g03210 Vitis vinifera VIT_07s0005g03210 I 0.000