Pm006709 (Prunus mume)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Pm006709 T333834_2.00 GigaDB (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.640 0.717
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.640 0.717
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.640 0.696
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.629 0.848
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.604 0.565
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.604 0.565
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pm006709 Sox 88 133

Links

Other Sox family TFs
Other Prunus mume TFs

544 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
23225_YPR052C Saccharomyces paradoxus 23225_YPR052C I 0.451
28200.m000191 Ricinus communis 28200.m000191 I 0.611
29631.m001046 Ricinus communis 29631.m001046 I 0.522
29854.m001136 Ricinus communis 29854.m001136 I 0.640
29927.m000626 Ricinus communis 29927.m000626 I 0.640
30174.m008839 Ricinus communis 30174.m008839 I 0.611
30174.m009083 Ricinus communis 30174.m009083 I 0.633
AFO Arabidopsis lyrata scaffold_403460.1 I 0.640
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.674
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.633
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.640
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.674
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.669
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.549
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.640
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.640
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.648
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.536
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.454
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.600
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.646
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.645
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.607
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.646
Bo3g037630 Brassica oleracea Bo3g037630 I 0.640
Bo3g041840 Brassica oleracea Bo3g041840 I 0.640
Bo4g195410 Brassica oleracea Bo4g195410 I 0.640
Bo5g009010 Brassica oleracea Bo5g009010 I 0.640
Bo5g039580 Brassica oleracea Bo5g039580 I 0.629
Bo6g073320 Brassica oleracea Bo6g073320 I 0.640
Bo6g108630 Brassica oleracea Bo6g108630 I 0.604
Bo7g056180 Brassica oleracea Bo7g056180 I 0.629
Bo8g055830 Brassica oleracea Bo8g055830 I 0.640
Bo8g112450 Brassica oleracea Bo8g112450 I 0.640
Bo9g001130 Brassica oleracea Bo9g001130 I 0.640
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.604
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.629
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.640
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.640
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.640
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.640
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.505
BOTBODRAFT_40635 Botryobasidium botryosum BOTBODRAFT_40635 N 0.416
Bra000378 Brassica rapa Bra000378 I 0.640
Bra000538 Brassica rapa Bra000538 I 0.640
Bra003309 Brassica rapa Bra003309 I 0.640
Bra004364 Brassica rapa Bra004364 I 0.604
Bra012373 Brassica rapa Bra012373 I 0.629
Bra018624 Brassica rapa Bra018624 I 0.640
Bra024599 Brassica rapa Bra024599 I 0.629
Bra030728 Brassica rapa Bra030728 I 0.640
Bra031629 Brassica rapa Bra031629 I 0.640
Bra037320 Brassica rapa Bra037320 I 0.640
Bra040322 Brassica rapa Bra040322 I 0.640
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.646
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.440
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.650
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.600
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.611
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.645
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.646
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.645
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.640
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.604
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.673
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.640
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.640
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.640
CapteG224864 Capitella teleta CapteG224864 I 0.438
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.640
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.640
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.673
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.604
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.640
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.640
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.633
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.640
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.640
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.611
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.617
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.707
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.633
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.611
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.640
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.640
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.633
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.640
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.639
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.611
Ca_06681 Cicer arietinum Ca_06681 I 0.640
Ca_07101 Cicer arietinum Ca_07101 I 0.640
Ca_12379 Cicer arietinum Ca_12379 I 0.633
Ca_18533 Cicer arietinum Ca_18533 I 0.633
Ca_21472 Cicer arietinum Ca_21472 I 0.594
Ca_25981 Cicer arietinum Ca_25981 I 0.611
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.416
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.627
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.555
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.640
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.611
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.611
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.640
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.622
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.600
Cla000824 Citrullus lanatus Cla000824 I 0.639
Cla005767 Citrullus lanatus Cla005767 I 0.584
Cla008752 Citrullus lanatus Cla008752 I 0.640
Cla010239 Citrullus lanatus Cla010239 I 0.634
Cla010397 Citrullus lanatus Cla010397 I 0.633
Cla011745 Citrullus lanatus Cla011745 I 0.611
Cla012424 Citrullus lanatus Cla012424 I 0.640
Cla016962 Citrullus lanatus Cla016962 I 0.674
CLEC000086 Cimex lectularius CLEC000086 N 0.421
CMT447C Cyanidioschyzon merolae CMT447C I 0.421
CND03770 Cryptococcus neoformans CND03770 I 0.492
CPIJ005084 Culex quinquefasciatus CPIJ005084 N 0.428
CpipJ_CPIJ005084 Culex pipiens CpipJ_CPIJ005084 N 0.428
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.604
CRC Vitis vinifera VIT_01s0011g00140 I 0.633
CRC Arabidopsis thaliana AT1G69180 D 0.604
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.640
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.674
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.633
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.615
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.640
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.611
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.611
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.639
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.428
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.494
E5Q_04235 Mixia osmundae E5Q_04235 I 0.420
E5Q_04236 Mixia osmundae E5Q_04236 I 0.420
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.534
EMIHUDRAFT_117867 Emiliania huxleyi EMIHUDRAFT_117867 I 0.427
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.439
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.534
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.422
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.422
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.633
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.603
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.640
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.640
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.611
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.640
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.568
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.422
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.633
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.640
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.640
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.611
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.645
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.640
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.663
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.457
F775_25525 Aegilops tauschii F775_25525 I 0.645
F775_27799 Aegilops tauschii F775_27799 I 0.645
F775_28710 Aegilops tauschii F775_28710 I 0.646
GALMADRAFT_234655 Galerina marginata GALMADRAFT_234655 N 0.420
GB50764 Apis mellifera GB50764 I 0.416
GE25578 Drosophila yakuba FBgn0242642 I 0.420
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.640
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.639
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.640
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.611
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.466
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.504
GLOINDRAFT_338425 Rhizophagus irregularis GLOINDRAFT_338425 I 0.425
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.572
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.545
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.452
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.599
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.633
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.438
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.611
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.633
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.611
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.438
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.636
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.645
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.661
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.640
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.665
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.640
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.640
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.640
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.640
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.640
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.645
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.665
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.640
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.640
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.611
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.674
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.633
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.640
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.496
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.645
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.640
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.640
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.640
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.645
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.607
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.645
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.646
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.611
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.646
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.600
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.600
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.640
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.646
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.646
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.611
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.645
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.440
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.645
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.645
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.594
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.594
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.594
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.646
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.666
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.636
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.624
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.650
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.600
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.640
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.650
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.600
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.688
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.600
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.650
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.640
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.645
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.650
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.636
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.666
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.645
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.672
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.656
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.536
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.576
H101_08199 Trichophyton interdigitale H101_08199 N 0.445
HelroG66455 Helobdella robusta HelroG66455 N 0.424
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.457
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.422
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.420
HPBE_0002300401 Heligmosomoides bakeri HPBE_0002300401 N 0.449
INO Arabidopsis thaliana AT1G23420 D 0.629
INO Vitis vinifera VIT_01s0127g00330 I 0.711
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.629
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.466
KGM_20190 Danaus plexippus KGM_20190 I 0.431
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.611
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.611
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.600
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.646
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.645
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.640
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.651
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.611
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.611
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.671
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.674
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.644
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.671
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.540
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.616
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.644
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.611
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.633
M404DRAFT_998370 Pisolithus tinctorius M404DRAFT_998370 N 0.435
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.500
M407DRAFT_28999 Tulasnella calospora M407DRAFT_28999 N 0.443
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.453
MCINX012524 Melitaea cinxia MCINX012524 I 0.431
MDOA001488 Musca domestica MDOA001488 I 0.420
MDP0000124879 Malus domestica MDP0000124879 I 0.604
MDP0000126221 Malus domestica MDP0000126221 I 0.668
MDP0000171878 Malus domestica MDP0000171878 I 0.604
MDP0000192940 Malus domestica MDP0000192940 I 0.611
MDP0000252640 Malus domestica MDP0000252640 I 0.640
MDP0000255415 Malus domestica MDP0000255415 I 0.640
MDP0000263713 Malus domestica MDP0000263713 I 0.674
MDP0000291729 Malus domestica MDP0000291729 I 0.604
MDP0000298333 Malus domestica MDP0000298333 I 0.611
MDP0000331808 Malus domestica MDP0000331808 I 0.640
MDP0000366291 Malus domestica MDP0000366291 I 0.640
MDP0000500810 Malus domestica MDP0000500810 I 0.640
mgf001016m Mimulus guttatus mgf001016m I 0.630
mgf003166m Mimulus guttatus mgf003166m I 0.611
mgf007067m Mimulus guttatus mgf007067m I 0.633
mgf009982m Mimulus guttatus mgf009982m I 0.674
mgf010765m Mimulus guttatus mgf010765m I 0.640
mgf011463m Mimulus guttatus mgf011463m I 0.611
mgf015806m Mimulus guttatus mgf015806m I 0.611
mgf015972m Mimulus guttatus mgf015972m I 0.640
mgf019496m Mimulus guttatus mgf019496m I 0.640
mgf023167m Mimulus guttatus mgf023167m I 0.665
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.645
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.646
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.611
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.646
Moror_16065 Moniliophthora roreri Moror_16065 I 0.498
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.640
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.611
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.640
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.645
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.640
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.623
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.440
NBR_0000051501 Nippostrongylus brasiliensis NBR_0000051501 N 0.443
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.431
NV13812 Nasonia vitripennis NV13812 I 0.427
OB02G33040 Oryza brachyantha OB02G33040 I 0.611
OB03G18700 Oryza brachyantha OB03G18700 I 0.600
OB03G35470 Oryza brachyantha OB03G35470 I 0.646
OB04G27010 Oryza brachyantha OB04G27010 I 0.645
OB07G12810 Oryza brachyantha OB07G12810 I 0.640
OB07G25220 Oryza brachyantha OB07G25220 I 0.608
OB12G26050 Oryza brachyantha OB12G26050 I 0.646
OBART02G25670 Oryza barthii OBART02G25670 I 0.611
OBART03G08320 Oryza barthii OBART03G08320 I 0.600
OBART03G27740 Oryza barthii OBART03G27740 I 0.646
OBART04G20010 Oryza barthii OBART04G20010 I 0.645
OBART10G15260 Oryza barthii OBART10G15260 I 0.611
OBART12G19190 Oryza barthii OBART12G19190 I 0.646
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.424
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.611
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.600
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.646
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.645
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.611
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.646
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.607
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.600
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.646
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.611
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.611
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.600
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.645
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.640
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.608
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.611
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.646
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.646
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.611
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.600
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.646
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.645
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.611
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.611
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.600
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.646
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.640
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.611
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.646
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.611
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.611
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.640
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.640
orange1.1g030283m.g Citrus sinensis orange1.1g030283m.g I 0.434
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.639
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.584
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.611
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.600
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.645
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.607
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.646
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.611
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.600
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.646
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.645
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.640
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.611
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.646
OS03G0215200 Oryza sativa OS03G0215200 I 0.600
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.426
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.426
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.645
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.645
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.607
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.640
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.607
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.646
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.646
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.645
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.645
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.646
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.600
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.600
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.611
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.646
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.600
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.620
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.465
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.674
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.640
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.640
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.640
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.611
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.637
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.640
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.459
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.448
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.416
PK06964.1 Cannabis sativa PK06964.1 I 0.640
PK09461.1 Cannabis sativa PK09461.1 I 0.640
PK13838.1 Cannabis sativa PK13838.1 I 0.633
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.483
Pm001547 Prunus mume Pm001547 I 0.640
Pm017846 Prunus mume Pm017846 I 0.611
Pm023555 Prunus mume Pm023555 I 0.611
Pm027559 Prunus mume Pm027559 I 0.640
Pm030598 Prunus mume Pm030598 I 0.633
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.473
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.611
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.611
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.611
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.640
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.600
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.660
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.677
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.627
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.611
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.645
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.640
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.611
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.611
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.640
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.640
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.633
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.741
PSEUBRA_SCAF20g03069 Pseudozyma brasiliensis PSEUBRA_SCAF20g03069 I 0.426
PV09_07652 Verruconis gallopava PV09_07652 I 0.423
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.417
RHTO_05868 Rhodosporidium toruloides RHTO_05868 I 0.415
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.455
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.611
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.640
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.671
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.627
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.600
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.611
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.616
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.645
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.677
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.640
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.611
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.640
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.611
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.611
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.640
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.646
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.611
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.600
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.640
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.645
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.645
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.646
SCHCODRAFT_73620 Schizophyllum commune SCHCODRAFT_73620 N 0.438
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.445
Si007288m.g Setaria italica Si007288m.g I 0.440
Si010859m.g Setaria italica Si010859m.g I 0.645
Si018146m.g Setaria italica Si018146m.g I 0.645
Si023308m.g Setaria italica Si023308m.g I 0.646
Si030811m.g Setaria italica Si030811m.g I 0.640
Si036788m.g Setaria italica Si036788m.g I 0.611
Si037608m.g Setaria italica Si037608m.g I 0.600
Si037789m.g Setaria italica Si037789m.g I 0.646
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.443
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.611
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.631
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.637
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.640
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.640
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.640
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.640
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.674
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.540
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.574
sr16632 Sporisorium reilianum sr16632 I 0.450
SVUK_0001721701 Strongylus vulgaris SVUK_0001721701 N 0.431
TCM_005549 Theobroma cacao TCM_005549 I 0.611
TCM_011484 Theobroma cacao TCM_011484 I 0.633
TCM_016030 Theobroma cacao TCM_016030 I 0.645
TCM_031868 Theobroma cacao TCM_031868 I 0.674
TCM_038105 Theobroma cacao TCM_038105 I 0.640
TCM_041175 Theobroma cacao TCM_041175 I 0.640
TELCIR_19210 Teladorsagia circumcincta TELCIR_19210 N 0.443
TELCIR_25179 Teladorsagia circumcincta TELCIR_25179 N 0.449
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.420
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.640
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.629
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.640
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.640
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.604
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.640
THITE_22048 Thielavia terrestris THITE_22048 I 0.448
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.611
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.645
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.645
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.590
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.600
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.600
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.600
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.646
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.646
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.646
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.646
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.646
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.646
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.645
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.645
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.645
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.646
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.646
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.611
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.645
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.600
UHOR_08529 Ustilago hordei UHOR_08529 I 0.460
UM06001 Ustilago maydis UM06001 I 0.455
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.645
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.649
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.611
YAB1 Oryza sativa OS07G0160100 I 0.640
YAB1 Arabidopsis thaliana AT2G45190 D 0.640
YAB2 Oryza sativa OS03G0650000 I 0.646
YAB2 Arabidopsis thaliana AT1G08465 I 0.640
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.674
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.640
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.640
YAB3 Oryza sativa OS10G0508300 I 0.611
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.640
YAB3 Arabidopsis thaliana AT4G00180 I 0.640
YAB4 Oryza sativa OS02G0643200 I 0.611
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.640
YAB5 Arabidopsis thaliana AT2G26580 D 0.640
YAB5 Oryza sativa OS04G0536300 I 0.645
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.640
YAB6 Oryza sativa OS12G0621100 I 0.646