29854.m001136 (Ricinus communis)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 29854.m001136 T333893_2.00 JGI (2012-Mar-17)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.737 0.955
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.955
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.955
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.682
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.682
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
29854.m001136 Sox 109 152

Links

Other Sox family TFs
Other Ricinus communis TFs

532 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.741
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.741
Si030811m.g Setaria italica Si030811m.g I 0.741
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.741
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.741
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.741
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.741
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.741
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.741
Ca_07101 Cicer arietinum Ca_07101 I 0.741
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.741
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.741
MDP0000331808 Malus domestica MDP0000331808 I 0.741
TCM_041175 Theobroma cacao TCM_041175 I 0.741
MDP0000252640 Malus domestica MDP0000252640 I 0.741
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.741
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.741
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.741
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.741
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.741
OB07G12810 Oryza brachyantha OB07G12810 I 0.741
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.741
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.741
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.741
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.741
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.741
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.741
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.741
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.741
PK06964.1 Cannabis sativa PK06964.1 I 0.741
YAB1 Oryza sativa OS07G0160100 I 0.741
Pm001547 Prunus mume Pm001547 I 0.741
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.741
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.741
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.741
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.741
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.741
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.737
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.737
Bo9g001130 Brassica oleracea Bo9g001130 I 0.737
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.737
Bo5g009010 Brassica oleracea Bo5g009010 I 0.737
YAB1 Arabidopsis thaliana AT2G45190 D 0.737
MDP0000366291 Malus domestica MDP0000366291 I 0.737
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.737
Bo6g073320 Brassica oleracea Bo6g073320 I 0.737
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.737
YAB3 Arabidopsis thaliana AT4G00180 I 0.737
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.737
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.737
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.737
Bo3g037630 Brassica oleracea Bo3g037630 I 0.737
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.737
AFO Arabidopsis lyrata scaffold_403460.1 I 0.737
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.737
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.737
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.737
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.737
MDP0000500810 Malus domestica MDP0000500810 I 0.737
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.737
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.737
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.737
Bo4g195410 Brassica oleracea Bo4g195410 I 0.737
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.737
Bra037320 Brassica rapa Bra037320 I 0.737
Bra031629 Brassica rapa Bra031629 I 0.737
Bra040322 Brassica rapa Bra040322 I 0.737
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.737
Cla008752 Citrullus lanatus Cla008752 I 0.737
Bra030728 Brassica rapa Bra030728 I 0.737
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.737
Bra000378 Brassica rapa Bra000378 I 0.737
Bra003309 Brassica rapa Bra003309 I 0.737
Bo8g112450 Brassica oleracea Bo8g112450 I 0.737
Bra018624 Brassica rapa Bra018624 I 0.737
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.737
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.737
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.737
YAB2 Arabidopsis thaliana AT1G08465 I 0.737
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.737
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.737
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.737
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.735
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.735
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.735
Si037789m.g Setaria italica Si037789m.g I 0.735
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.731
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.731
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.731
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.731
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.731
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.731
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.731
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.731
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.731
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.731
YAB2 Oryza sativa OS03G0650000 I 0.731
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.731
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.731
YAB6 Oryza sativa OS12G0621100 I 0.731
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.731
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.731
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.731
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.731
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.731
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.731
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.731
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.731
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.731
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.731
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.731
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.731
OBART12G19190 Oryza barthii OBART12G19190 I 0.731
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.731
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.731
F775_28710 Aegilops tauschii F775_28710 I 0.731
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.731
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.731
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.731
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.731
OB03G35470 Oryza brachyantha OB03G35470 I 0.731
Si023308m.g Setaria italica Si023308m.g I 0.731
OB12G26050 Oryza brachyantha OB12G26050 I 0.731
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.731
OBART03G27740 Oryza barthii OBART03G27740 I 0.731
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.731
Bo8g055830 Brassica oleracea Bo8g055830 I 0.730
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.730
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.727
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.727
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.726
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.724
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.724
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.724
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.720
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.714
Cla012424 Citrullus lanatus Cla012424 I 0.711
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.711
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.711
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.711
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.710
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.709
mgf011463m Mimulus guttatus mgf011463m I 0.708
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.708
mgf003166m Mimulus guttatus mgf003166m I 0.708
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.708
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.708
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.708
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.708
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.708
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.708
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.708
mgf015806m Mimulus guttatus mgf015806m I 0.708
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.708
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.708
TCM_005549 Theobroma cacao TCM_005549 I 0.708
28200.m000191 Ricinus communis 28200.m000191 I 0.708
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.708
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.708
Si036788m.g Setaria italica Si036788m.g I 0.708
30174.m008839 Ricinus communis 30174.m008839 I 0.708
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.708
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.708
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.708
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.708
Cla011745 Citrullus lanatus Cla011745 I 0.708
Ca_25981 Cicer arietinum Ca_25981 I 0.708
Pm017846 Prunus mume Pm017846 I 0.708
Pm023555 Prunus mume Pm023555 I 0.708
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.708
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.708
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.708
YAB3 Oryza sativa OS10G0508300 I 0.708
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.708
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.708
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.708
YAB4 Oryza sativa OS02G0643200 I 0.708
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.708
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.708
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.708
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.708
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.708
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.708
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.708
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.708
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.708
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.708
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.708
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.708
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.708
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.708
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.708
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.708
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.708
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.708
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.708
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.708
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.708
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.708
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.708
MDP0000298333 Malus domestica MDP0000298333 I 0.708
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.708
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.708
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.708
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.708
MDP0000192940 Malus domestica MDP0000192940 I 0.708
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.708
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.708
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.708
OBART10G15260 Oryza barthii OBART10G15260 I 0.708
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.708
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.708
OBART02G25670 Oryza barthii OBART02G25670 I 0.708
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.708
OB02G33040 Oryza brachyantha OB02G33040 I 0.708
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.708
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.707
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.707
Ca_06681 Cicer arietinum Ca_06681 I 0.707
mgf009982m Mimulus guttatus mgf009982m I 0.707
MDP0000255415 Malus domestica MDP0000255415 I 0.707
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.707
mgf015972m Mimulus guttatus mgf015972m I 0.707
TCM_038105 Theobroma cacao TCM_038105 I 0.707
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.707
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.707
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.707
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.707
mgf010765m Mimulus guttatus mgf010765m I 0.707
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.707
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.707
mgf019496m Mimulus guttatus mgf019496m I 0.707
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.707
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.707
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.707
PK09461.1 Cannabis sativa PK09461.1 I 0.707
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.707
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.707
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.707
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.707
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.707
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.707
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.707
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.707
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.707
YAB5 Arabidopsis thaliana AT2G26580 D 0.707
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.707
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.707
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.707
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.707
Pm027559 Prunus mume Pm027559 I 0.707
Bra000538 Brassica rapa Bra000538 I 0.707
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.707
Bo3g041840 Brassica oleracea Bo3g041840 I 0.707
29927.m000626 Ricinus communis 29927.m000626 I 0.707
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.703
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.702
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.702
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.702
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.702
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.702
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.702
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.701
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.697
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.697
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.694
Pm030598 Prunus mume Pm030598 I 0.689
30174.m009083 Ricinus communis 30174.m009083 I 0.689
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.689
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.689
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.689
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.689
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.689
TCM_011484 Theobroma cacao TCM_011484 I 0.689
CRC Vitis vinifera VIT_01s0011g00140 I 0.689
PK13838.1 Cannabis sativa PK13838.1 I 0.689
Ca_12379 Cicer arietinum Ca_12379 I 0.689
Ca_18533 Cicer arietinum Ca_18533 I 0.689
Cla010397 Citrullus lanatus Cla010397 I 0.689
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.689
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.689
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.689
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.689
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.689
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.689
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.689
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.683
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.683
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.683
mgf007067m Mimulus guttatus mgf007067m I 0.683
Cla005767 Citrullus lanatus Cla005767 I 0.681
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.680
OBART04G20010 Oryza barthii OBART04G20010 I 0.678
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.678
Si010859m.g Setaria italica Si010859m.g I 0.678
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.678
OB04G27010 Oryza brachyantha OB04G27010 I 0.678
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.678
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.678
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.678
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.678
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.678
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.678
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.678
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.678
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.678
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.678
YAB5 Oryza sativa OS04G0536300 I 0.678
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.674
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.674
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.674
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.674
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.674
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.674
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.674
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.674
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.674
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.674
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.674
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.674
F775_27799 Aegilops tauschii F775_27799 I 0.674
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.674
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.674
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.674
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.674
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.674
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.674
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.674
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.674
F775_25525 Aegilops tauschii F775_25525 I 0.674
TCM_016030 Theobroma cacao TCM_016030 I 0.674
Si018146m.g Setaria italica Si018146m.g I 0.674
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.674
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.674
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.673
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.673
Cla016962 Citrullus lanatus Cla016962 I 0.673
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.669
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.669
INO Vitis vinifera VIT_01s0127g00330 I 0.669
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.667
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.666
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.666
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.661
TCM_031868 Theobroma cacao TCM_031868 I 0.660
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.660
Bo6g108630 Brassica oleracea Bo6g108630 I 0.660
CRC Arabidopsis thaliana AT1G69180 D 0.660
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.660
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.660
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.660
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.660
Bra004364 Brassica rapa Bra004364 I 0.660
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.660
MDP0000124879 Malus domestica MDP0000124879 I 0.660
MDP0000291729 Malus domestica MDP0000291729 I 0.660
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.658
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.657
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.657
mgf001016m Mimulus guttatus mgf001016m I 0.657
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.657
OB03G18700 Oryza brachyantha OB03G18700 I 0.657
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.657
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.657
OBART03G08320 Oryza barthii OBART03G08320 I 0.657
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.657
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.657
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.657
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.657
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.657
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.657
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.657
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.657
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.657
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.657
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.657
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.657
OS03G0215200 Oryza sativa OS03G0215200 I 0.657
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.657
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.657
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.657
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.657
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.657
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.657
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.657
Si037608m.g Setaria italica Si037608m.g I 0.657
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.655
MDP0000171878 Malus domestica MDP0000171878 I 0.654
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.651
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.650
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.650
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.643
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.640
Pm006709 Prunus mume Pm006709 I 0.640
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.640
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.640
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.640
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.640
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.640
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.640
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.640
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.640
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.640
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.632
MDP0000126221 Malus domestica MDP0000126221 I 0.632
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.632
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.632
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.632
MDP0000263713 Malus domestica MDP0000263713 I 0.632
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.627
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.627
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.625
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.618
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.618
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.618
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.616
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.614
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.614
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.611
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.606
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.605
Ca_21472 Cicer arietinum Ca_21472 I 0.603
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.602
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.602
Cla000824 Citrullus lanatus Cla000824 I 0.602
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.596
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.596
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.596
INO Arabidopsis thaliana AT1G23420 D 0.596
Bra012373 Brassica rapa Bra012373 I 0.596
Bo7g056180 Brassica oleracea Bo7g056180 I 0.596
Bo5g039580 Brassica oleracea Bo5g039580 I 0.596
Bra024599 Brassica rapa Bra024599 I 0.596
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.596
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.594
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.593
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.579
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.574
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.574
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.574
OB07G25220 Oryza brachyantha OB07G25220 I 0.574
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.574
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.574
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.570
mgf023167m Mimulus guttatus mgf023167m I 0.569
Cla010239 Citrullus lanatus Cla010239 I 0.567
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.567
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.567
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.567
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.564
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.553
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.552
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.552
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.547
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.538
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
Moror_16065 Moniliophthora roreri Moror_16065 I 0.522
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
29631.m001046 Ricinus communis 29631.m001046 I 0.514
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.479
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.477
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.477
PV09_07652 Verruconis gallopava PV09_07652 I 0.474
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.472
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.470
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.467
CND03770 Cryptococcus neoformans CND03770 I 0.467
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
sr16632 Sporisorium reilianum sr16632 I 0.464
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.456
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
mgf012563m Mimulus guttatus mgf012563m I 0.443
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.440
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.440
EMIHUDRAFT_117867 Emiliania huxleyi EMIHUDRAFT_117867 I 0.440
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.440
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.440
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.437
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.437
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.435
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.435
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.434
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
Si007288m.g Setaria italica Si007288m.g I 0.433
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.433
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.433
GB50764 Apis mellifera GB50764 I 0.433
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.433
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
UM06001 Ustilago maydis UM06001 I 0.430
Hba_16915 Heterorhabditis bacteriophora Hba_16915 I 0.429
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
GK13574 Drosophila willistoni FBgn0215582 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.427
GH18160 Drosophila grimshawi FBgn0125628 I 0.427
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.427
MDOA001488 Musca domestica MDOA001488 I 0.427
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.427
GE25578 Drosophila yakuba FBgn0242642 I 0.427
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.427
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.426
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.425
ENSCING00000000505 Ciona intestinalis ENSCING00000000505 I 0.423
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.422
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
ACEP12759 Atta cephalotes ACEP12759 I 0.420
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.419
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
HPBE_0002300401 Heligmosomoides bakeri HPBE_0002300401 N 0.419
THITE_22048 Thielavia terrestris THITE_22048 I 0.417
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.416
E5Q_04235 Mixia osmundae E5Q_04235 I 0.416
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.416
KGM_20190 Danaus plexippus KGM_20190 I 0.416
NV13812 Nasonia vitripennis NV13812 I 0.416
E5Q_04236 Mixia osmundae E5Q_04236 I 0.416
MCINX012524 Melitaea cinxia MCINX012524 I 0.416
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415