29854.m001136 (Ricinus communis)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 29854.m001136 T333893_2.00 JGI (2012-Mar-17)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.737 0.955
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.955
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.955
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.682
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.682
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
29854.m001136 Sox 109 152

Links

Other Sox family TFs
Other Ricinus communis TFs

532 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Nr1h2 Mus musculus ENSMUSG00000060601 D 0.000
Smp_105090 Schistosoma mansoni Smp_105090 D 0.000
Hr46 Drosophila melanogaster FBgn0000448 D 0.000
EcR Drosophila melanogaster FBgn0000546 D 0.000
Rorb Mus musculus ENSMUSG00000036192 D 0.000
Nr1h3 Mus musculus ENSMUSG00000002108 D 0.000
Nr2f6 Mus musculus ENSMUSG00000002393 D 0.000
Nr2c2 Mus musculus ENSMUSG00000005893 D 0.000
RORB Homo sapiens ENSG00000198963 D 0.000
NR2C2 Homo sapiens ENSG00000177463 D 0.000
NR2F6 Homo sapiens ENSG00000160113 D 0.000
NR1H4 Homo sapiens ENSG00000012504 D 0.000
Nr1h4 Mus musculus ENSMUSG00000047638 D 0.000
O77476_BRUPA Brugia pahangi O77476_BRUPA D 0.000
rorb Tetraodon nigroviridis ENSTNIG00000014682 D 0.000
NR1H3 Homo sapiens ENSG00000025434 D 0.000
AAEL009588 Aedes aegypti AAEL009588 D 0.000
RORC Tetraodon nigroviridis ENSTNIG00000018347 D 0.000
nr1h5.S Xenopus laevis XB-GENE-6251607 D 0.000
ENSMMUP00000037145 Macaca fascicularis ENSMMUP00000037145 I 0.000
ENSMMUP00000031505 Macaca fascicularis ENSMMUP00000031505 I 0.000
ENSP00000379507 Macaca fascicularis ENSP00000379507 I 0.000
ENSP00000380083-D1 Bos grunniens ENSP00000380083-D1 I 0.000
Afo_R010049 Aptenodytes forsteri Afo_R010049 I 0.000
Afo_R012936 Aptenodytes forsteri Afo_R012936 I 0.000
Afo_R002975 Aptenodytes forsteri Afo_R002975 I 0.000
ENSP00000188403 Macaca fascicularis ENSP00000188403 I 0.000
Gfo_R008263 Geospiza fortis Gfo_R008263 I 0.000
Gfo_R007588 Geospiza fortis Gfo_R007588 I 0.000
Gfo_R005191 Geospiza fortis Gfo_R005191 I 0.000
Gfo_R002171 Geospiza fortis Gfo_R002171 I 0.000
Brh_R003242 Buceros rhinoceros Brh_R003242 I 0.000
Afo_R001939 Aptenodytes forsteri Afo_R001939 I 0.000
Afo_R007393 Aptenodytes forsteri Afo_R007393 I 0.000
ENSP00000380083 Macaca fascicularis ENSP00000380083 I 0.000
Afo_R002292 Aptenodytes forsteri Afo_R002292 I 0.000
ENSBTAP00000028921-D1 Bos grunniens ENSBTAP00000028921-D1 I 0.000
ENSBTAP00000018079-D1 Bos grunniens ENSBTAP00000018079-D1 I 0.000
ENSBTAP00000014791-D1 Bos grunniens ENSBTAP00000014791-D1 I 0.000
Cflo_02082--XP_392128.3_APIME Camponotus floridanus Cflo_02082--XP_392128.3_APIME I 0.000
Alligator_sinensis_CCG013209.1 Alligator sinensis Alligator_sinensis_CCG013209.1 I 0.000
Brh_R011894 Buceros rhinoceros Brh_R011894 I 0.000
Brh_R011463 Buceros rhinoceros Brh_R011463 I 0.000
Brh_R007727 Buceros rhinoceros Brh_R007727 I 0.000
Brh_R002313 Buceros rhinoceros Brh_R002313 I 0.000
Alligator_sinensis_CCG018282.1 Alligator sinensis Alligator_sinensis_CCG018282.1 I 0.000
Alligator_sinensis_CCG017637.1 Alligator sinensis Alligator_sinensis_CCG017637.1 I 0.000
Alligator_sinensis_CCG016940.1 Alligator sinensis Alligator_sinensis_CCG016940.1 I 0.000
Alligator_sinensis_CCG007724.1 Alligator sinensis Alligator_sinensis_CCG007724.1 I 0.000
Cmyd_10004101 Chelonia mydas Cmyd_10004101 I 0.000
ENSBTAP00000014131-D1 Bos grunniens ENSBTAP00000014131-D1 I 0.000
ENSBTAP00000004229-D1 Bos grunniens ENSBTAP00000004229-D1 I 0.000
Cmyd_10021697 Chelonia mydas Cmyd_10021697 I 0.000
Cmyd_10020443 Chelonia mydas Cmyd_10020443 I 0.000
Alligator_sinensis_CCG000418.1 Alligator sinensis Alligator_sinensis_CCG000418.1 I 0.000
Alligator_sinensis_CCG004779.1 Alligator sinensis Alligator_sinensis_CCG004779.1 I 0.000
Cmyd_10015477 Chelonia mydas Cmyd_10015477 I 0.000
Cmyd_10014955 Chelonia mydas Cmyd_10014955 I 0.000
Cmyd_10006717 Chelonia mydas Cmyd_10006717 I 0.000
Aan_R011707 Calypte anna Aan_R011707 I 0.000
Sjc_0026760 Schistosoma japonicum Sjc_0026760 I 0.000
fgenesh2_kg.scaffold_27000001 Branchiostoma floridae fgenesh2_kg.scaffold_27000001 I 0.000
estExt_fgenesh2_pg.C_3830006 Branchiostoma floridae estExt_fgenesh2_pg.C_3830006 I 0.000
estExt_fgenesh2_pg.C_2910013 Branchiostoma floridae estExt_fgenesh2_pg.C_2910013 I 0.000
estExt_fgenesh2_pg.C_1640037 Branchiostoma floridae estExt_fgenesh2_pg.C_1640037 I 0.000
e_gw.91.63.1 Branchiostoma floridae e_gw.91.63.1 I 0.000
e_gw.91.225.1 Branchiostoma floridae e_gw.91.225.1 I 0.000
e_gw.704.13.1 Branchiostoma floridae e_gw.704.13.1 I 0.000
Tal_R013008 Tyto alba Tal_R013008 I 0.000
gw.2854.3.1 Branchiostoma floridae gw.2854.3.1 I 0.000
Ocbimv22009591m.g Octopus bimaculoides Ocbimv22009591m.g I 0.000
Ocbimv22037319m.g Octopus bimaculoides Ocbimv22037319m.g I 0.000
Sjc_0019140 Schistosoma japonicum Sjc_0019140 I 0.000
LCUP007589 Lucilia cuprina LCUP007589 I 0.000
LCUP005897 Lucilia cuprina LCUP005897 I 0.000
CLEC025067 Cimex lectularius CLEC025067 I 0.000
Sakowv30035171m.g Saccoglossus kowalevskii Sakowv30035171m.g I 0.000
Sakowv30027208m.g Saccoglossus kowalevskii Sakowv30027208m.g I 0.000
Sakowv30016920m.g Saccoglossus kowalevskii Sakowv30016920m.g I 0.000
Sakowv30012194m.g Saccoglossus kowalevskii Sakowv30012194m.g I 0.000
Tal_R010110 Tyto alba Tal_R010110 I 0.000
Tal_R006235 Tyto alba Tal_R006235 I 0.000
Myotis_brandtii_RORB_10034418 Myotis brandtii Myotis_brandtii_RORB_10034418 I 0.000
Myotis_brandtii_NR2C2_10028273 Myotis brandtii Myotis_brandtii_NR2C2_10028273 I 0.000
Myotis_brandtii_NR1H4_10025557 Myotis brandtii Myotis_brandtii_NR1H4_10025557 I 0.000
Myotis_brandtii_NR1H3_10025520 Myotis brandtii Myotis_brandtii_NR1H3_10025520 I 0.000
Ogr06168 Ophisaurus gracilis Ogr06168 I 0.000
Myotis_brandtii_NR1H2_10017687 Myotis brandtii Myotis_brandtii_NR1H2_10017687 I 0.000
Hsal_00190--XP_392128.3_APIME Harpegnathos saltator Hsal_00190--XP_392128.3_APIME I 0.000
Gfo_R014176 Geospiza fortis Gfo_R014176 I 0.000
Ogr04328 Ophisaurus gracilis Ogr04328 I 0.000
Ogr07445 Ophisaurus gracilis Ogr07445 I 0.000
Ogr14476 Ophisaurus gracilis Ogr14476 I 0.000
Pvit_18004 Pogona vitticeps Pvit_18004 I 0.000
Pvit_17674 Pogona vitticeps Pvit_17674 I 0.000
Pvit_16564 Pogona vitticeps Pvit_16564 I 0.000
Pvit_15387 Pogona vitticeps Pvit_15387 I 0.000
Pvit_12494 Pogona vitticeps Pvit_12494 I 0.000
Pvit_09871 Pogona vitticeps Pvit_09871 I 0.000
Pvit_08677 Pogona vitticeps Pvit_08677 I 0.000
Ogr17890 Ophisaurus gracilis Ogr17890 I 0.000
Gfo_R010069 Geospiza fortis Gfo_R010069 I 0.000
Aan_R010496 Calypte anna Aan_R010496 I 0.000
EcR Drosophila pseudoobscura FBgn0243551 I 0.000
GI20211 Drosophila mojavensis FBgn0142947 I 0.000
GH20948 Drosophila grimshawi FBgn0128410 I 0.000
GH20117 Drosophila grimshawi FBgn0127581 I 0.000
GG25225 Drosophila erecta FBgn0117349 I 0.000
GG10830 Drosophila erecta FBgn0103135 I 0.000
GF13818 Drosophila ananassae FBgn0090845 I 0.000
GF12134 Drosophila ananassae FBgn0089173 I 0.000
GA17350 Drosophila pseudoobscura FBgn0077363 I 0.000
ENSXMAG00000018442 Xiphophorus maculatus ENSXMAG00000018442 I 0.000
ENSXMAG00000016651 Xiphophorus maculatus ENSXMAG00000016651 I 0.000
GI21285 Drosophila mojavensis FBgn0144015 I 0.000
GL10487 Drosophila persimilis FBgn0148097 I 0.000
GE21721 Drosophila yakuba FBgn0238967 I 0.000
GE19426 Drosophila yakuba FBgn0236769 I 0.000
GK21996 Drosophila willistoni FBgn0223981 I 0.000
GK18019 Drosophila willistoni FBgn0220018 I 0.000
GJ20887 Drosophila virilis FBgn0208023 I 0.000
GJ20161 Drosophila virilis FBgn0207301 I 0.000
GD26001 Drosophila simulans FBgn0197277 I 0.000
GD10334 Drosophila simulans FBgn0182106 I 0.000
GM16480 Drosophila sechellia FBgn0171395 I 0.000
GL16258 Drosophila persimilis FBgn0153862 I 0.000
ENSXMAG00000015890 Xiphophorus maculatus ENSXMAG00000015890 I 0.000
ENSXMAG00000015567 Xiphophorus maculatus ENSXMAG00000015567 I 0.000
NR1H2 Tursiops truncatus ENSTTRG00000002416 I 0.000
ENSTSYG00000014206 Tarsius syrichta ENSTSYG00000014206 I 0.000
ENSTSYG00000007907 Tarsius syrichta ENSTSYG00000007907 I 0.000
nr2c1 Takifugu rubripes ENSTRUG00000016957 I 0.000
nr1h3 Takifugu rubripes ENSTRUG00000016403 I 0.000
nr2c2 Takifugu rubripes ENSTRUG00000011580 I 0.000
NR2F6 Takifugu rubripes ENSTRUG00000008495 I 0.000
nr1h5 Takifugu rubripes ENSTRUG00000008191 I 0.000
nr1h4 Takifugu rubripes ENSTRUG00000007314 I 0.000
NR2F6 Takifugu rubripes ENSTRUG00000004353 I 0.000
NR2F6 Tursiops truncatus ENSTTRG00000003132 I 0.000
NR2C2 Tursiops truncatus ENSTTRG00000009876 I 0.000
ENSXMAG00000014983 Xiphophorus maculatus ENSXMAG00000014983 I 0.000
ENSXMAG00000012678 Xiphophorus maculatus ENSXMAG00000012678 I 0.000
ENSXMAG00000006999 Xiphophorus maculatus ENSXMAG00000006999 I 0.000
ENSXMAG00000002376 Xiphophorus maculatus ENSXMAG00000002376 I 0.000
ENSXMAG00000001433 Xiphophorus maculatus ENSXMAG00000001433 I 0.000
ENSXMAG00000000014 Xiphophorus maculatus ENSXMAG00000000014 I 0.000
NR1H3 Vicugna pacos ENSVPAG00000011840 I 0.000
RORB Vicugna pacos ENSVPAG00000003390 I 0.000
NR1H4 Tursiops truncatus ENSTTRG00000016373 I 0.000
NR1H3 Tursiops truncatus ENSTTRG00000014149 I 0.000
ENSTRUG00000002901 Takifugu rubripes ENSTRUG00000002901 I 0.000
Aan_R009242 Calypte anna Aan_R009242 I 0.000
SPU_028255 Strongylocentrotus purpuratus SPU_028255 I 0.000
SPU_018845 Strongylocentrotus purpuratus SPU_018845 I 0.000
SPU_011348 Strongylocentrotus purpuratus SPU_011348 I 0.000
SPU_008117 Strongylocentrotus purpuratus SPU_008117 I 0.000
Smp_174750 Schistosoma mansoni Smp_174750 I 0.000
Smp_144170 Schistosoma mansoni Smp_144170 I 0.000
Smp_139360 Schistosoma mansoni Smp_139360 I 0.000
Smp_097700 Schistosoma mansoni Smp_097700 I 0.000
SMAR007871 Strigamia maritima SMAR007871 I 0.000
RPRC003681 Rhodnius prolixus RPRC003681 I 0.000
TC008909 Tribolium castaneum TC008909 I 0.000
tetur03g08440 Tetranychus urticae tetur03g08440 I 0.000
Aan_R006662 Calypte anna Aan_R006662 I 0.000
Aan_R004446 Calypte anna Aan_R004446 I 0.000
WBGene00245913 Onchocerca volvulus WBGene00245913 I 0.000
WBGene00241550 Onchocerca volvulus WBGene00241550 I 0.000
WBGene00237444 Onchocerca volvulus WBGene00237444 I 0.000
WBGene00237273 Onchocerca volvulus WBGene00237273 I 0.000
WBGene00237162 Onchocerca volvulus WBGene00237162 I 0.000
WBGene00237160 Onchocerca volvulus WBGene00237160 I 0.000
nhr-41 Caenorhabditis elegans WBGene00022423 I 0.000
nhr-23 Caenorhabditis elegans WBGene00003622 I 0.000
Ppa-sex-1 Pristionchus pacificus PPA19965 I 0.000
Ppa-unc-55 Pristionchus pacificus PPA04999 I 0.000
L798_14277 Zootermopsis nevadensis L798_14277 I 0.000
KGM_08219 Danaus plexippus KGM_08219 I 0.000
KGM_07654 Danaus plexippus KGM_07654 I 0.000
HMEL012265 Heliconius melpomene HMEL012265 I 0.000
HelroG92366 Helobdella robusta HelroG92366 I 0.000
HelroG191405 Helobdella robusta HelroG191405 I 0.000
HelroG127751 Helobdella robusta HelroG127751 I 0.000
HelroG127595 Helobdella robusta HelroG127595 I 0.000
HelroG127541 Helobdella robusta HelroG127541 I 0.000
GB47512 Apis mellifera GB47512 I 0.000
LOAG_00337 Loa loa LOAG_00337 I 0.000
LOAG_05209 Loa loa LOAG_05209 I 0.000
PHUM053030 Pediculus humanus PHUM053030 I 0.000
NEMVEDRAFT_v1g167880 Nematostella vectensis NEMVEDRAFT_v1g167880 I 0.000
MESCA004840 Megaselia scalaris MESCA004840 I 0.000
LotgiG58866 Lottia gigantea LotgiG58866 I 0.000
LotgiG238472 Lottia gigantea LotgiG238472 I 0.000
LotgiG170342 Lottia gigantea LotgiG170342 I 0.000
LotgiG129003 Lottia gigantea LotgiG129003 I 0.000
LotgiG126514 Lottia gigantea LotgiG126514 I 0.000
LOAG_17726 Loa loa LOAG_17726 I 0.000
LOAG_16842 Loa loa LOAG_16842 I 0.000
GA24101 Drosophila pseudoobscura FBgn0245500 I 0.000
nOo.2.0.1.g07306 Onchocerca ochengi nOo.2.0.1.g07306 I 0.000
nDi.2.2.2.g01984 Dirofilaria immitis nDi.2.2.2.g01984 I 0.000
nDi.2.2.2.g01326 Dirofilaria immitis nDi.2.2.2.g01326 I 0.000
nDi.2.2.2.g01009 Dirofilaria immitis nDi.2.2.2.g01009 I 0.000
NBR_0001980401 Nippostrongylus brasiliensis NBR_0001980401 I 0.000
NBR_0001130501 Nippostrongylus brasiliensis NBR_0001130501 I 0.000
nAv.1.0.1.g05558 Acanthocheilonema viteae nAv.1.0.1.g05558 I 0.000
nAv.1.0.1.g04088 Acanthocheilonema viteae nAv.1.0.1.g04088 I 0.000
nAv.1.0.1.g03443 Acanthocheilonema viteae nAv.1.0.1.g03443 I 0.000
nAv.1.0.1.g02667 Acanthocheilonema viteae nAv.1.0.1.g02667 I 0.000
MhA1_Contig91.frz3.fgene1 Meloidogyne hapla MhA1_Contig91.frz3.fgene1 I 0.000
nDi.2.2.2.g09622 Dirofilaria immitis nDi.2.2.2.g09622 I 0.000
nDi.2.2.2.g09953 Dirofilaria immitis nDi.2.2.2.g09953 I 0.000
nOo.2.0.1.g04971 Onchocerca ochengi nOo.2.0.1.g04971 I 0.000
nOo.2.0.1.g02962 Onchocerca ochengi nOo.2.0.1.g02962 I 0.000
nLs.2.1.2.g07992 Litomosoides sigmodontis nLs.2.1.2.g07992 I 0.000
nLs.2.1.2.g05295 Litomosoides sigmodontis nLs.2.1.2.g05295 I 0.000
nLs.2.1.2.g03574 Litomosoides sigmodontis nLs.2.1.2.g03574 I 0.000
nLs.2.1.2.g01548 Litomosoides sigmodontis nLs.2.1.2.g01548 I 0.000
NECAME_14581 Necator americanus NECAME_14581 I 0.000
NECAME_12319 Necator americanus NECAME_12319 I 0.000
NECAME_11142 Necator americanus NECAME_11142 I 0.000
nDi.2.2.2.g09956 Dirofilaria immitis nDi.2.2.2.g09956 I 0.000
L898_g4691 Steinernema monticolum L898_g4691 I 0.000
L898_g35396 Steinernema monticolum L898_g35396 I 0.000
L889_g7283 Steinernema feltiae L889_g7283 I 0.000
L889_g28055 Steinernema feltiae L889_g28055 I 0.000
L889_g17804 Steinernema feltiae L889_g17804 I 0.000
L596_g24646 Steinernema carpocapsae L596_g24646 I 0.000
L596_g23334 Steinernema carpocapsae L596_g23334 I 0.000
L596_g17964 Steinernema carpocapsae L596_g17964 I 0.000
L596_g17693 Steinernema carpocapsae L596_g17693 I 0.000
L596_g17227 Steinernema carpocapsae L596_g17227 I 0.000
L596_g16701 Steinernema carpocapsae L596_g16701 I 0.000
L596_g14378 Steinernema carpocapsae L596_g14378 I 0.000
L889_g9307 Steinernema feltiae L889_g9307 I 0.000
L892_g13043 Steinernema scapterisci L892_g13043 I 0.000
L898_g17470 Steinernema monticolum L898_g17470 I 0.000
L898_g17415 Steinernema monticolum L898_g17415 I 0.000
L898_g14201 Steinernema monticolum L898_g14201 I 0.000
L893_g6815 Steinernema glaseri L893_g6815 I 0.000
L893_g33993 Steinernema glaseri L893_g33993 I 0.000
L893_g32675 Steinernema glaseri L893_g32675 I 0.000
L893_g14086 Steinernema glaseri L893_g14086 I 0.000
L892_g28997 Steinernema scapterisci L892_g28997 I 0.000
L892_g24092 Steinernema scapterisci L892_g24092 I 0.000
L892_g17164 Steinernema scapterisci L892_g17164 I 0.000
HPLM_0001731801 Haemonchus placei HPLM_0001731801 I 0.000
TTRE_0000285101 Trichuris trichiura TTRE_0000285101 I 0.000
TCLT_0000569201 Thelazia callipaeda TCLT_0000569201 I 0.000
TCLT_0000218901 Thelazia callipaeda TCLT_0000218901 I 0.000
TCLT_0000045701 Thelazia callipaeda TCLT_0000045701 I 0.000
T265_03243 Opisthorchis viverrini T265_03243 I 0.000
T265_00408 Opisthorchis viverrini T265_00408 I 0.000
SVUK_0000075101 Strongylus vulgaris SVUK_0000075101 I 0.000
SVE_0162100 Strongyloides venezuelensis SVE_0162100 I 0.000
SSTP_0000766500 Strongyloides stercoralis SSTP_0000766500 I 0.000
SSTP_0000571300 Strongyloides stercoralis SSTP_0000571300 I 0.000
SROB_0001506101 Schistosoma rodhaini SROB_0001506101 I 0.000
TCLT_0000642701 Thelazia callipaeda TCLT_0000642701 I 0.000
TCLT_0000877001 Thelazia callipaeda TCLT_0000877001 I 0.000
TRE_0001518101 Trichobilharzia regenti TRE_0001518101 I 0.000
TMUE_s0008014200 Trichuris muris TMUE_s0008014200 I 0.000
TMUE_s0002001200 Trichuris muris TMUE_s0002001200 I 0.000
TMUE_s0001000700 Trichuris muris TMUE_s0001000700 I 0.000
TELCIR_23664 Teladorsagia circumcincta TELCIR_23664 I 0.000
TELCIR_16351 Teladorsagia circumcincta TELCIR_16351 I 0.000
TELCIR_02548 Teladorsagia circumcincta TELCIR_02548 I 0.000
TCNE_0001579701 Toxocara canis TCNE_0001579701 I 0.000
TCNE_0001577801 Toxocara canis TCNE_0001577801 I 0.000
TCNE_0001111701 Toxocara canis TCNE_0001111701 I 0.000
SROB_0000947001 Schistosoma rodhaini SROB_0000947001 I 0.000
SPAL_0001289900 Strongyloides papillosus SPAL_0001289900 I 0.000
RSKR_0000337300 Rhabditophanes kr3021 RSKR_0000337300 I 0.000
PTRK_0000641400 Parastrongyloides trichosuri PTRK_0000641400 I 0.000
PTRK_0000297600 Parastrongyloides trichosuri PTRK_0000297600 I 0.000
OFLC_0000996401 Onchocerca flexuosa OFLC_0000996401 I 0.000
OFLC_0000536201 Onchocerca flexuosa OFLC_0000536201 I 0.000
OFLC_0000511401 Onchocerca flexuosa OFLC_0000511401 I 0.000
OESDEN_09670 Oesophagostomum dentatum OESDEN_09670 I 0.000
OESDEN_06389 Oesophagostomum dentatum OESDEN_06389 I 0.000
nRc.2.0.1.g46780 Romanomermis culicivorax nRc.2.0.1.g46780 I 0.000
nRc.2.0.1.g36086 Romanomermis culicivorax nRc.2.0.1.g36086 I 0.000
RSKR_0000528200 Rhabditophanes kr3021 RSKR_0000528200 I 0.000
SCUD_0000777901 Schistosoma curassoni SCUD_0000777901 I 0.000
snap_masked-nMf.1.1.scaf00912-processed-gene-0.11 Meloidogyne floridensis snap_masked-nMf.1.1.scaf00912-processed-gene-0.11 I 0.000
SMUV_0001016301 Syphacia muris SMUV_0001016301 I 0.000
SMUV_0000538301 Syphacia muris SMUV_0000538301 I 0.000
SMUV_0000490601 Syphacia muris SMUV_0000490601 I 0.000
SMUV_0000054801 Syphacia muris SMUV_0000054801 I 0.000
SMTD_0001915201 Schistosoma mattheei SMTD_0001915201 I 0.000
SMTD_0001158701 Schistosoma mattheei SMTD_0001158701 I 0.000
SMTD_0001086101 Schistosoma mattheei SMTD_0001086101 I 0.000
SMRZ_0001531701 Schistosoma margrebowiei SMRZ_0001531701 I 0.000
SCUD_0001665801 Schistosoma curassoni SCUD_0001665801 I 0.000
nOo.2.0.1.g08426 Onchocerca ochengi nOo.2.0.1.g08426 I 0.000
A_00017 Schistosoma haematobium A_00017 I 0.000
AMEM018998 Anopheles merus AMEM018998 I 0.000
AMEM011649 Anopheles merus AMEM011649 I 0.000
AMEC000069 Anopheles melas AMEC000069 I 0.000
AFUN015736 Anopheles funestus AFUN015736 I 0.000
AFUN005646 Anopheles funestus AFUN005646 I 0.000
AFAF021556 Anopheles farauti AFAF021556 I 0.000
AFAF003674 Anopheles farauti AFAF003674 I 0.000
AEPI000843 Anopheles epiroticus AEPI000843 I 0.000
AEPI000053 Anopheles epiroticus AEPI000053 I 0.000
ADIR005051 Anopheles dirus ADIR005051 I 0.000
AMIN006955 Anopheles minimus AMIN006955 I 0.000
AMIN009445 Anopheles minimus AMIN009445 I 0.000
PPAI003337 Phlebotomus papatasi PPAI003337 I 0.000
MDOA014655 Musca domestica MDOA014655 I 0.000
MDOA013387 Musca domestica MDOA013387 I 0.000
BGLB013636 Biomphalaria glabrata BGLB013636 I 0.000
BGLB011692 Biomphalaria glabrata BGLB011692 I 0.000
BGLB006818 Biomphalaria glabrata BGLB006818 I 0.000
ASTEI02489 Anopheles stephensi ASTEI02489 I 0.000
ASTEI01984 Anopheles stephensi ASTEI01984 I 0.000
AQUA002870 Anopheles quadriannulatus AQUA002870 I 0.000
AQUA002307 Anopheles quadriannulatus AQUA002307 I 0.000
ADIR001886 Anopheles dirus ADIR001886 I 0.000
ACUA018625 Anopheles culicifacies ACUA018625 I 0.000
nr1h5 Xenopus tropicalis XB-GENE-486722 I 0.000
rorb Xenopus tropicalis XB-GENE-484846 I 0.000
nr1h2 Xenopus tropicalis XB-GENE-482950 I 0.000
nr2c2 Xenopus tropicalis XB-GENE-482536 I 0.000
nr2f6.L Xenopus laevis XB-GENE-480822 I 0.000
nr2f6 Xenopus tropicalis XB-GENE-480818 I 0.000
SMU15033023 Schmidtea mediterranea SMU15033023 I 0.000
SMU15015484 Schmidtea mediterranea SMU15015484 I 0.000
Sjc_0058250 Schistosoma japonicum Sjc_0058250 I 0.000
Sjc_0057690 Schistosoma japonicum Sjc_0057690 I 0.000
nr1h5.L Xenopus laevis XB-GENE-864860 I 0.000
nr1h2.L Xenopus laevis XB-GENE-864925 I 0.000
ACUA000806 Anopheles culicifacies ACUA000806 I 0.000
ACOM040478 Anopheles coluzzii ACOM040478 I 0.000
ACOM026429 Anopheles coluzzii ACOM026429 I 0.000
AATE015478 Anopheles atroparvus AATE015478 I 0.000
AATE000030 Anopheles atroparvus AATE000030 I 0.000
AARA009565 Anopheles arabiensis AARA009565 I 0.000
AARA003299 Anopheles arabiensis AARA003299 I 0.000
AALB010791 Anopheles albimanus AALB010791 I 0.000
AALB001895 Anopheles albimanus AALB001895 I 0.000
rorb.2 Xenopus tropicalis XB-GENE-922434 I 0.000
Sjc_0050600 Schistosoma japonicum Sjc_0050600 I 0.000
HPBE_0002253301 Heligmosomoides bakeri HPBE_0002253301 I 0.000
DICVIV_05958 Dictyocaulus viviparus DICVIV_05958 I 0.000
DICVIV_02571 Dictyocaulus viviparus DICVIV_02571 I 0.000
D918_09717 Trichuris suis D918_09717 I 0.000
D918_07931 Trichuris suis D918_07931 I 0.000
D918_02615 Trichuris suis D918_02615 I 0.000
D917_09075 Trichinella nativa D917_09075 I 0.000
D917_06357 Trichinella nativa D917_06357 I 0.000
D917_00700 Trichinella nativa D917_00700 I 0.000
D915_09414 Fasciola hepatica D915_09414 I 0.000
D915_05677 Fasciola hepatica D915_05677 I 0.000
DME_0000359001 Dracunculus medinensis DME_0000359001 I 0.000
DME_0000391501 Dracunculus medinensis DME_0000391501 I 0.000
HCOI00910600 Haemonchus contortus HCOI00910600 I 0.000
HCOI00794000 Haemonchus contortus HCOI00794000 I 0.000
HCOI00459200 Haemonchus contortus HCOI00459200 I 0.000
HCOI00433800 Haemonchus contortus HCOI00433800 I 0.000
Hba_20244 Heterorhabditis bacteriophora Hba_20244 I 0.000
GPUH_0000103801 Gongylonema pulchrum GPUH_0000103801 I 0.000
GPLIN_001122300 Globodera pallida GPLIN_001122300 I 0.000
GPLIN_000153900 Globodera pallida GPLIN_000153900 I 0.000
EVEC_0001227801 Enterobius vermicularis EVEC_0001227801 I 0.000
EEL_0000192101 Elaeophora elaphi EEL_0000192101 I 0.000
D915_01136 Fasciola hepatica D915_01136 I 0.000
csin111400 Clonorchis sinensis csin111400 I 0.000
ANCCEY_04472 Ancylostoma ceylanicum ANCCEY_04472 I 0.000
ANCCAN_12205 Ancylostoma caninum ANCCAN_12205 I 0.000
ANCCAN_11234 Ancylostoma caninum ANCCAN_11234 I 0.000
ANCCAN_02463 Ancylostoma caninum ANCCAN_02463 I 0.000
ALUE_0000465801 Ascaris lumbricoides ALUE_0000465801 I 0.000
ALUE_0000420701 Ascaris lumbricoides ALUE_0000420701 I 0.000
ACOC_0001278301 Angiostrongylus costaricensis ACOC_0001278301 I 0.000
A_05498 Schistosoma haematobium A_05498 I 0.000
A_02067 Schistosoma haematobium A_02067 I 0.000
A_01819 Schistosoma haematobium A_01819 I 0.000
ANCCEY_11543 Ancylostoma ceylanicum ANCCEY_11543 I 0.000
ANCDUO_05038 Ancylostoma duodenale ANCDUO_05038 I 0.000
csin106105 Clonorchis sinensis csin106105 I 0.000
BXY_0810300 Bursaphelenchus xylophilus BXY_0810300 I 0.000
BTMF_0001566801 Brugia timori BTMF_0001566801 I 0.000
BTMF_0001180601 Brugia timori BTMF_0001180601 I 0.000
BTMF_0001121901 Brugia timori BTMF_0001121901 I 0.000
ASU_12959 Ascaris suum ASU_12959 I 0.000
ASU_11275 Ascaris suum ASU_11275 I 0.000
ASU_10805 Ascaris suum ASU_10805 I 0.000
ASU_08381 Ascaris suum ASU_08381 I 0.000
ASIM_0001539601 Anisakis simplex ASIM_0001539601 I 0.000
A_00851 Schistosoma haematobium A_00851 I 0.000
ENSFALG00000012763 Ficedula albicollis ENSFALG00000012763 I 0.000
RORB Equus caballus ENSECAG00000024312 I 0.000
NR1H2 Equus caballus ENSECAG00000020882 I 0.000
NR1H4 Equus caballus ENSECAG00000018166 I 0.000
NR1H3 Equus caballus ENSECAG00000015726 I 0.000
ENSECAG00000015617 Equus caballus ENSECAG00000015617 I 0.000
NR2C2 Equus caballus ENSECAG00000003791 I 0.000
Nr1h3 Dipodomys ordii ENSDORG00000007747 I 0.000
Nr2c2 Dipodomys ordii ENSDORG00000007038 I 0.000
Nr1h4 Dipodomys ordii ENSDORG00000001224 I 0.000
NR1H3 Erinaceus europaeus ENSEEUG00000003283 I 0.000
NR2C2 Erinaceus europaeus ENSEEUG00000011354 I 0.000
NR1H4 Erinaceus europaeus ENSEEUG00000012218 I 0.000
ENSFALG00000011082 Ficedula albicollis ENSFALG00000011082 I 0.000
ENSFALG00000006313 Ficedula albicollis ENSFALG00000006313 I 0.000
ENSFALG00000003389 Ficedula albicollis ENSFALG00000003389 I 0.000
NR1H4 Echinops telfairi ENSETEG00000019430 I 0.000
NR1H2 Echinops telfairi ENSETEG00000018821 I 0.000
RORB Echinops telfairi ENSETEG00000017457 I 0.000
NR2C2 Echinops telfairi ENSETEG00000005089 I 0.000
NR1H3 Echinops telfairi ENSETEG00000000415 I 0.000
RORB Erinaceus europaeus ENSEEUG00000014274 I 0.000
Nr1h2 Dipodomys ordii ENSDORG00000001148 I 0.000
NR1H4 Dasypus novemcinctus ENSDNOG00000047912 I 0.000
ENSDNOG00000034800 Dasypus novemcinctus ENSDNOG00000034800 I 0.000
ENSCSAVG00000009992 Ciona savignyi ENSCSAVG00000009992 I 0.000
ENSCSAG00000009209 Chlorocebus sabaeus ENSCSAG00000009209 I 0.000
ENSCSAG00000008161 Chlorocebus sabaeus ENSCSAG00000008161 I 0.000
ENSCSAG00000005699 Chlorocebus sabaeus ENSCSAG00000005699 I 0.000
ENSCSAG00000005651 Chlorocebus sabaeus ENSCSAG00000005651 I 0.000
ENSCSAG00000003451 Chlorocebus sabaeus ENSCSAG00000003451 I 0.000
ENSCSAG00000002181 Chlorocebus sabaeus ENSCSAG00000002181 I 0.000
NR2F6 Cavia porcellus ENSCPOG00000025861 I 0.000
NR1H3 Cavia porcellus ENSCPOG00000013362 I 0.000
nr2f6b Danio rerio ENSDARG00000003165 I 0.000
nr2f6a Danio rerio ENSDARG00000003607 I 0.000
nr1h5 Danio rerio ENSDARG00000031046 I 0.000
NR1H2 Dasypus novemcinctus ENSDNOG00000034506 I 0.000
NR1H3 Dasypus novemcinctus ENSDNOG00000011206 I 0.000
NR2C2 Dasypus novemcinctus ENSDNOG00000006388 I 0.000
nr1h3 Danio rerio ENSDARG00000098439 I 0.000
rorc Danio rerio ENSDARG00000087195 I 0.000
nr1h4 Danio rerio ENSDARG00000057741 I 0.000
nr2c1 Danio rerio ENSDARG00000045527 I 0.000
nr2c2 Danio rerio ENSDARG00000042477 I 0.000
rorb Danio rerio ENSDARG00000033498 I 0.000
RORB Cavia porcellus ENSCPOG00000010612 I 0.000
NR2C2 Loxodonta africana ENSLAFG00000010224 I 0.000
ENSGMOG00000015966 Gadus morhua ENSGMOG00000015966 I 0.000
ENSGMOG00000010346 Gadus morhua ENSGMOG00000010346 I 0.000
ENSGMOG00000008012 Gadus morhua ENSGMOG00000008012 I 0.000
ENSGMOG00000005399 Gadus morhua ENSGMOG00000005399 I 0.000
ENSGMOG00000003773 Gadus morhua ENSGMOG00000003773 I 0.000
NR2C2 Gorilla gorilla ENSGGOG00000015479 I 0.000
RORB Gorilla gorilla ENSGGOG00000011970 I 0.000
NR1H3 Gorilla gorilla ENSGGOG00000008583 I 0.000
NR1H4 Gorilla gorilla ENSGGOG00000008137 I 0.000
ENSGMOG00000017040 Gadus morhua ENSGMOG00000017040 I 0.000
ENSGMOG00000018291 Gadus morhua ENSGMOG00000018291 I 0.000
ENSLACG00000006103 Latimeria chalumnae ENSLACG00000006103 I 0.000
NR1H3 Loxodonta africana ENSLAFG00000009267 I 0.000
NR1H4 Loxodonta africana ENSLAFG00000009154 I 0.000
NR1H2 Loxodonta africana ENSLAFG00000008751 I 0.000
NR2F6 Loxodonta africana ENSLAFG00000007367 I 0.000
ENSLACG00000018964 Latimeria chalumnae ENSLACG00000018964 I 0.000
ENSLACG00000018478 Latimeria chalumnae ENSLACG00000018478 I 0.000
ENSLACG00000015170 Latimeria chalumnae ENSLACG00000015170 I 0.000
ENSLACG00000012803 Latimeria chalumnae ENSLACG00000012803 I 0.000
ENSLACG00000010723 Latimeria chalumnae ENSLACG00000010723 I 0.000
NR1H2 Gorilla gorilla ENSGGOG00000005607 I 0.000
RORB Gallus gallus ENSGALG00000015150 I 0.000
NR1H4 Gallus gallus ENSGALG00000011594 I 0.000
nr2c2 Gasterosteus aculeatus ENSGACG00000002941 I 0.000
NR1H2 Homo sapiens ENSG00000131408 I 0.000
ENSFCAG00000028538 Felis catus ENSFCAG00000028538 I 0.000
RORB Felis catus ENSFCAG00000011421 I 0.000
NR1H2 Felis catus ENSFCAG00000009177 I 0.000
NR1H4 Felis catus ENSFCAG00000006469 I 0.000
NR2C2 Felis catus ENSFCAG00000003537 I 0.000
NR1H3 Felis catus ENSFCAG00000002528 I 0.000
NR2F6 Felis catus ENSFCAG00000000999 I 0.000
nr1h5 Gasterosteus aculeatus ENSGACG00000004938 I 0.000
NR2F6 Gasterosteus aculeatus ENSGACG00000007766 I 0.000
nr2c1 Gasterosteus aculeatus ENSGACG00000010174 I 0.000
NR2C2 Gallus gallus ENSGALG00000008519 I 0.000
ENSGALG00000008202 Gallus gallus ENSGALG00000008202 I 0.000
ENSGALG00000002170 Gallus gallus ENSGALG00000002170 I 0.000
ENSGALG00000001035 Gallus gallus ENSGALG00000001035 I 0.000
nr1h3 Gasterosteus aculeatus ENSGACG00000017167 I 0.000
NR2F6 Gasterosteus aculeatus ENSGACG00000015583 I 0.000
RORC Gasterosteus aculeatus ENSGACG00000012239 I 0.000
nr1h4 Gasterosteus aculeatus ENSGACG00000011745 I 0.000
rorb Gasterosteus aculeatus ENSGACG00000011556 I 0.000
ENSFALG00000013685 Ficedula albicollis ENSFALG00000013685 I 0.000
ENSAMEG00000010370 Ailuropoda melanoleuca ENSAMEG00000010370 I 0.000
CRE17552 Caenorhabditis remanei CRE17552 I 0.000
CRE07841 Caenorhabditis remanei CRE07841 I 0.000
CPIJ018862 Culex quinquefasciatus CPIJ018862 I 0.000
CPIJ002963 Culex quinquefasciatus CPIJ002963 I 0.000
CJA19190 Caenorhabditis japonica CJA19190 I 0.000
CJA17689 Caenorhabditis japonica CJA17689 I 0.000
CGI_10011509 Crassostrea gigas CGI_10011509 I 0.000
CGI_10007606 Crassostrea gigas CGI_10007606 I 0.000
CGI_10003107 Crassostrea gigas CGI_10003107 I 0.000
DAPPUDRAFT_301472 Daphnia pulex DAPPUDRAFT_301472 I 0.000
DAPPUDRAFT_311954 Daphnia pulex DAPPUDRAFT_311954 I 0.000
EFV52739 Trichinella spiralis EFV52739 I 0.000
ENSAMEG00000007298 Ailuropoda melanoleuca ENSAMEG00000007298 I 0.000
ENSAMEG00000004318 Ailuropoda melanoleuca ENSAMEG00000004318 I 0.000
NR1H2 Anolis carolinensis ENSACAG00000012517 I 0.000
NR1H4 Anolis carolinensis ENSACAG00000012333 I 0.000
NR2C2 Anolis carolinensis ENSACAG00000012082 I 0.000
ENSACAG00000003336 Anolis carolinensis ENSACAG00000003336 I 0.000
NR1H3 Anolis carolinensis ENSACAG00000002940 I 0.000
EFV59686 Trichinella spiralis EFV59686 I 0.000
EFV58098 Trichinella spiralis EFV58098 I 0.000
CBN04090 Caenorhabditis brenneri CBN04090 I 0.000
CBN03950 Caenorhabditis brenneri CBN03950 I 0.000
CBN02985 Caenorhabditis brenneri CBN02985 I 0.000
HR3 Anopheles gambiae AGAP009002 I 0.000
ADAC010413 Anopheles darlingi ADAC010413 I 0.000
ADAC008672 Anopheles darlingi ADAC008672 I 0.000
ACYPI56793 Acyrthosiphon pisum ACYPI56793 I 0.000
ECR Aedes aegypti AAEL009600 I 0.000
WUBG_01907 Wuchereria bancrofti WUBG_01907 I 0.000
WUBG_01875 Wuchereria bancrofti WUBG_01875 I 0.000
WUBG_00356 Wuchereria bancrofti WUBG_00356 I 0.000
CpipJ_CPIJ018862 Culex pipiens CpipJ_CPIJ018862 I 0.000
AGAP012211 Anopheles gambiae AGAP012211 I 0.000
BGIBMGA006767 Bombyx mori BGIBMGA006767 I 0.000
BGIBMGA009688 Bombyx mori BGIBMGA009688 I 0.000
CBG21929 Caenorhabditis briggsae CBG21929 I 0.000
CBG13935 Caenorhabditis briggsae CBG13935 I 0.000
CapteG227484 Capitella teleta CapteG227484 I 0.000
CapteG125155 Capitella teleta CapteG125155 I 0.000
Bm7221 Brugia malayi Bm7221 I 0.000
Bm7018 Brugia malayi Bm7018 I 0.000
Bm4429 Brugia malayi Bm4429 I 0.000
Bm2982 Brugia malayi Bm2982 I 0.000
Bm1896 Brugia malayi Bm1896 I 0.000
CpipJ_CPIJ002963 Culex pipiens CpipJ_CPIJ002963 I 0.000
NR1H2 Cavia porcellus ENSCPOG00000002835 I 0.000
NR2C2 Choloepus hoffmanni ENSCHOG00000002709 I 0.000
NR1H3 Choloepus hoffmanni ENSCHOG00000001621 I 0.000
NR2F2 Canis familiaris ENSCAFG00000024861 I 0.000
NR2F6 Canis familiaris ENSCAFG00000015487 I 0.000
ENSCAFG00000009671 Canis familiaris ENSCAFG00000009671 I 0.000
NR1H3 Canis familiaris ENSCAFG00000008824 I 0.000
NR1H4 Canis familiaris ENSCAFG00000006835 I 0.000
NR2C2 Canis familiaris ENSCAFG00000004535 I 0.000
NR1H2 Canis familiaris ENSCAFG00000003338 I 0.000
RORB Choloepus hoffmanni ENSCHOG00000009723 I 0.000
NR1H4 Choloepus hoffmanni ENSCHOG00000013215 I 0.000
coup Ciona intestinalis ENSCING00000002023 I 0.000
NR1H4 Cavia porcellus ENSCPOG00000002168 I 0.000
NR2C2 Cavia porcellus ENSCPOG00000001512 I 0.000
NR1H3 Callithrix jacchus ENSCJAG00000020019 I 0.000
NR2C2 Callithrix jacchus ENSCJAG00000017131 I 0.000
NR2F6 Callithrix jacchus ENSCJAG00000009593 I 0.000
NR1H2 Callithrix jacchus ENSCJAG00000004439 I 0.000
NR1H4 Callithrix jacchus ENSCJAG00000002087 I 0.000
RORB Callithrix jacchus ENSCJAG00000001216 I 0.000
ENSCING00000002152 Ciona intestinalis ENSCING00000002152 I 0.000
RORB Canis familiaris ENSCAFG00000001769 I 0.000
RORB Bos taurus ENSBTAG00000021699 I 0.000
NR2C2 Bos taurus ENSBTAG00000013716 I 0.000
ENSAMXG00000019070 Astyanax mexicanus ENSAMXG00000019070 I 0.000
ENSAMXG00000019022 Astyanax mexicanus ENSAMXG00000019022 I 0.000
ENSAMXG00000018669 Astyanax mexicanus ENSAMXG00000018669 I 0.000
ENSAMXG00000012228 Astyanax mexicanus ENSAMXG00000012228 I 0.000
ENSAMXG00000006277 Astyanax mexicanus ENSAMXG00000006277 I 0.000
ENSAMXG00000005769 Astyanax mexicanus ENSAMXG00000005769 I 0.000
ENSAMEG00000017106 Ailuropoda melanoleuca ENSAMEG00000017106 I 0.000
ENSAMEG00000015664 Ailuropoda melanoleuca ENSAMEG00000015664 I 0.000
ENSAMEG00000015232 Ailuropoda melanoleuca ENSAMEG00000015232 I 0.000
ENSAMXG00000019916 Astyanax mexicanus ENSAMXG00000019916 I 0.000
ENSAMXG00000020274 Astyanax mexicanus ENSAMXG00000020274 I 0.000
ENSAPLG00000007187 Anas platyrhynchos ENSAPLG00000007187 I 0.000
NR1H4 Bos taurus ENSBTAG00000013596 I 0.000
NR2F6 Bos taurus ENSBTAG00000011136 I 0.000
NR1H3 Bos taurus ENSBTAG00000010681 I 0.000
NR1H2 Bos taurus ENSBTAG00000003264 I 0.000
ENSAPLG00000013289 Anas platyrhynchos ENSAPLG00000013289 I 0.000
ENSAPLG00000011493 Anas platyrhynchos ENSAPLG00000011493 I 0.000
ENSAPLG00000010925 Anas platyrhynchos ENSAPLG00000010925 I 0.000
ENSAPLG00000008338 Anas platyrhynchos ENSAPLG00000008338 I 0.000
ENSAPLG00000007538 Anas platyrhynchos ENSAPLG00000007538 I 0.000
ENSAMEG00000013215 Ailuropoda melanoleuca ENSAMEG00000013215 I 0.000
RORB Loxodonta africana ENSLAFG00000012757 I 0.000
Nr2c2 Rattus norvegicus ENSRNOG00000010536 I 0.000
ENSPSIG00000013773 Pelodiscus sinensis ENSPSIG00000013773 I 0.000
ENSPSIG00000010360 Pelodiscus sinensis ENSPSIG00000010360 I 0.000
ENSPSIG00000008928 Pelodiscus sinensis ENSPSIG00000008928 I 0.000
ENSPSIG00000005774 Pelodiscus sinensis ENSPSIG00000005774 I 0.000
ENSPSIG00000005579 Pelodiscus sinensis ENSPSIG00000005579 I 0.000
ENSPSIG00000003828 Pelodiscus sinensis ENSPSIG00000003828 I 0.000
ENSPPYG00000019294 Pongo abelii ENSPPYG00000019294 I 0.000
ENSPPYG00000013408 Pongo abelii ENSPPYG00000013408 I 0.000
ENSPPYG00000010280 Pongo abelii ENSPPYG00000010280 I 0.000
ENSPSIG00000016262 Pelodiscus sinensis ENSPSIG00000016262 I 0.000
NR1H3 Pan troglodytes ENSPTRG00000003560 I 0.000
NR1H4 Pan troglodytes ENSPTRG00000005345 I 0.000
Nr1h4 Rattus norvegicus ENSRNOG00000007197 I 0.000
NR2C2 Pteropus vampyrus ENSPVAG00000017233 I 0.000
NR1H4 Pteropus vampyrus ENSPVAG00000014680 I 0.000
RORB Pteropus vampyrus ENSPVAG00000007216 I 0.000
NR1H2 Pteropus vampyrus ENSPVAG00000002570 I 0.000
RORB Pan troglodytes ENSPTRG00000021025 I 0.000
NR2C2 Pan troglodytes ENSPTRG00000014657 I 0.000
NR1H2 Pan troglodytes ENSPTRG00000011337 I 0.000
NR2F6 Pan troglodytes ENSPTRG00000010661 I 0.000
ENSPPYG00000009703 Pongo abelii ENSPPYG00000009703 I 0.000
ENSPPYG00000004867 Pongo abelii ENSPPYG00000004867 I 0.000
ENSPPYG00000003309 Pongo abelii ENSPPYG00000003309 I 0.000
RORB Procavia capensis ENSPCAG00000012274 I 0.000
NR2F6 Procavia capensis ENSPCAG00000009765 I 0.000
NR1H2 Procavia capensis ENSPCAG00000000352 I 0.000
ENSPANG00000024927 Papio anubis ENSPANG00000024927 I 0.000
ENSPANG00000023009 Papio anubis ENSPANG00000023009 I 0.000
ENSPANG00000016658 Papio anubis ENSPANG00000016658 I 0.000
ENSPANG00000012797 Papio anubis ENSPANG00000012797 I 0.000
ENSPANG00000005929 Papio anubis ENSPANG00000005929 I 0.000
rorb Oryzias latipes ENSORLG00000012441 I 0.000
NR1H3 Procavia capensis ENSPCAG00000016194 I 0.000
ENSPFOG00000000838 Poecilia formosa ENSPFOG00000000838 I 0.000
ENSPFOG00000002136 Poecilia formosa ENSPFOG00000002136 I 0.000
ENSPMAG00000009286 Petromyzon marinus ENSPMAG00000009286 I 0.000
ENSPFOG00000016166 Poecilia formosa ENSPFOG00000016166 I 0.000
ENSPFOG00000016102 Poecilia formosa ENSPFOG00000016102 I 0.000
ENSPFOG00000015880 Poecilia formosa ENSPFOG00000015880 I 0.000
ENSPFOG00000015704 Poecilia formosa ENSPFOG00000015704 I 0.000
ENSPFOG00000012037 Poecilia formosa ENSPFOG00000012037 I 0.000
ENSPFOG00000011747 Poecilia formosa ENSPFOG00000011747 I 0.000
ENSPFOG00000011449 Poecilia formosa ENSPFOG00000011449 I 0.000
ENSPFOG00000003798 Poecilia formosa ENSPFOG00000003798 I 0.000
nr1h4 Oryzias latipes ENSORLG00000011270 I 0.000
RORC Takifugu rubripes ENSTRUG00000001436 I 0.000
RORB Taeniopygia guttata ENSTGUG00000000785 I 0.000
ENSTGUG00000000264 Taeniopygia guttata ENSTGUG00000000264 I 0.000
NR1H4 Tupaia belangeri ENSTBEG00000016715 I 0.000
NR2F6 Tupaia belangeri ENSTBEG00000016199 I 0.000
RORB Tupaia belangeri ENSTBEG00000010761 I 0.000
NR1H2 Tupaia belangeri ENSTBEG00000006715 I 0.000
NR2C2 Tupaia belangeri ENSTBEG00000002424 I 0.000
NR1H3 Tupaia belangeri ENSTBEG00000000492 I 0.000
ENSSTOG00000029231 Ictidomys tridecemlineatus ENSSTOG00000029231 I 0.000
ENSTGUG00000000964 Taeniopygia guttata ENSTGUG00000000964 I 0.000
NR1H4 Taeniopygia guttata ENSTGUG00000008977 I 0.000
ENSTGUG00000010475 Taeniopygia guttata ENSTGUG00000010475 I 0.000
nr2c2 Tetraodon nigroviridis ENSTNIG00000017919 I 0.000
nr2c1 Tetraodon nigroviridis ENSTNIG00000016018 I 0.000
nr1h4 Tetraodon nigroviridis ENSTNIG00000012144 I 0.000
NR2F6 Tetraodon nigroviridis ENSTNIG00000011055 I 0.000
NR2F6 Tetraodon nigroviridis ENSTNIG00000010182 I 0.000
nr1h3 Tetraodon nigroviridis ENSTNIG00000009590 I 0.000
nr1h5 Tetraodon nigroviridis ENSTNIG00000004195 I 0.000
nr1h5 Tetraodon nigroviridis ENSTNIG00000003487 I 0.000
NR2C2 Taeniopygia guttata ENSTGUG00000010590 I 0.000
ENSSTOG00000027072 Ictidomys tridecemlineatus ENSSTOG00000027072 I 0.000
ENSSTOG00000013264 Ictidomys tridecemlineatus ENSSTOG00000013264 I 0.000
ENSSTOG00000011771 Ictidomys tridecemlineatus ENSSTOG00000011771 I 0.000
ENSSHAG00000010518 Sarcophilus harrisii ENSSHAG00000010518 I 0.000
ENSSHAG00000002191 Sarcophilus harrisii ENSSHAG00000002191 I 0.000
NR1H2 Sorex araneus ENSSARG00000005452 I 0.000
NR1H4 Sorex araneus ENSSARG00000004689 I 0.000
NR2C2 Sorex araneus ENSSARG00000004504 I 0.000
Nr1h5 Rattus norvegicus ENSRNOG00000023073 I 0.000
Nr1h2 Rattus norvegicus ENSRNOG00000019812 I 0.000
Nr2f6 Rattus norvegicus ENSRNOG00000016892 I 0.000
Rorb Rattus norvegicus ENSRNOG00000013413 I 0.000
ENSSHAG00000012333 Sarcophilus harrisii ENSSHAG00000012333 I 0.000
ENSSHAG00000016078 Sarcophilus harrisii ENSSHAG00000016078 I 0.000
ENSSHAG00000017152 Sarcophilus harrisii ENSSHAG00000017152 I 0.000
ENSSTOG00000011725 Ictidomys tridecemlineatus ENSSTOG00000011725 I 0.000
ENSSTOG00000007611 Ictidomys tridecemlineatus ENSSTOG00000007611 I 0.000
NR2F6 Sus scrofa ENSSSCG00000013873 I 0.000
NR1H3 Sus scrofa ENSSSCG00000013241 I 0.000
NR2C2 Sus scrofa ENSSSCG00000011594 I 0.000
RORB Sus scrofa ENSSSCG00000005268 I 0.000
NR1H2 Sus scrofa ENSSSCG00000003211 I 0.000
NR1H4 Sus scrofa ENSSSCG00000000875 I 0.000
ENSSHAG00000018693 Sarcophilus harrisii ENSSHAG00000018693 I 0.000
Nr1h3 Rattus norvegicus ENSRNOG00000013172 I 0.000
ENSNLEG00000005616 Nomascus leucogenys ENSNLEG00000005616 I 0.000
NR2C2 Monodelphis domestica ENSMODG00000007047 I 0.000
NR1H4 Monodelphis domestica ENSMODG00000004996 I 0.000
ENSMODG00000004721 Monodelphis domestica ENSMODG00000004721 I 0.000
ENSMODG00000004462 Monodelphis domestica ENSMODG00000004462 I 0.000
RORB Monodelphis domestica ENSMODG00000002046 I 0.000
NR2F6 Macaca mulatta ENSMMUG00000028849 I 0.000
NR1H2 Macaca mulatta ENSMMUG00000023418 I 0.000
NR1H3 Macaca mulatta ENSMMUG00000015598 I 0.000
RORB Macaca mulatta ENSMMUG00000012571 I 0.000
NR2F6 Monodelphis domestica ENSMODG00000015049 I 0.000
NR1H3 Monodelphis domestica ENSMODG00000019906 I 0.000
ENSMPUG00000001934 Mustela putorius furo ENSMPUG00000001934 I 0.000
ENSNLEG00000005193 Nomascus leucogenys ENSNLEG00000005193 I 0.000
ENSNLEG00000001398 Nomascus leucogenys ENSNLEG00000001398 I 0.000
Nr1h5 Mus musculus ENSMUSG00000048938 I 0.000
ENSMPUG00000017249 Mustela putorius furo ENSMPUG00000017249 I 0.000
ENSMPUG00000015918 Mustela putorius furo ENSMPUG00000015918 I 0.000
ENSMPUG00000011573 Mustela putorius furo ENSMPUG00000011573 I 0.000
ENSMPUG00000008883 Mustela putorius furo ENSMPUG00000008883 I 0.000
ENSMPUG00000005775 Mustela putorius furo ENSMPUG00000005775 I 0.000
ENSMPUG00000004787 Mustela putorius furo ENSMPUG00000004787 I 0.000
NR2C2 Macaca mulatta ENSMMUG00000005156 I 0.000
NR1H4 Macaca mulatta ENSMMUG00000003571 I 0.000
NR1H3 Myotis lucifugus ENSMLUG00000017646 I 0.000
ENSMGAG00000002222 Meleagris gallopavo ENSMGAG00000002222 I 0.000
ENSMEUG00000009703 Macropus eugenii ENSMEUG00000009703 I 0.000
ENSMEUG00000002853 Macropus eugenii ENSMEUG00000002853 I 0.000
ENSLOCG00000015757 Lepisosteus oculatus ENSLOCG00000015757 I 0.000
ENSLOCG00000015206 Lepisosteus oculatus ENSLOCG00000015206 I 0.000
ENSLOCG00000011160 Lepisosteus oculatus ENSLOCG00000011160 I 0.000
ENSLOCG00000010390 Lepisosteus oculatus ENSLOCG00000010390 I 0.000
ENSLOCG00000009712 Lepisosteus oculatus ENSLOCG00000009712 I 0.000
ENSLOCG00000002897 Lepisosteus oculatus ENSLOCG00000002897 I 0.000
NR2C2 Meleagris gallopavo ENSMGAG00000010372 I 0.000
NR1H3 Meleagris gallopavo ENSMGAG00000010751 I 0.000
NR1H4 Meleagris gallopavo ENSMGAG00000011690 I 0.000
NR2F6 Myotis lucifugus ENSMLUG00000014386 I 0.000
NR2C2 Myotis lucifugus ENSMLUG00000010062 I 0.000
NR1H4 Myotis lucifugus ENSMLUG00000009273 I 0.000
RORB Myotis lucifugus ENSMLUG00000006436 I 0.000
NR1H2 Myotis lucifugus ENSMLUG00000004897 I 0.000
NR1H4 Microcebus murinus ENSMICG00000013522 I 0.000
RORB Microcebus murinus ENSMICG00000007512 I 0.000
NR1H3 Microcebus murinus ENSMICG00000007066 I 0.000
NR1H2 Microcebus murinus ENSMICG00000002174 I 0.000
ENSLAFG00000028744 Loxodonta africana ENSLAFG00000028744 I 0.000
nr2c2 Oryzias latipes ENSORLG00000010877 I 0.000
ENSONIG00000010762 Oreochromis niloticus ENSONIG00000010762 I 0.000
ENSONIG00000010512 Oreochromis niloticus ENSONIG00000010512 I 0.000
ENSONIG00000010104 Oreochromis niloticus ENSONIG00000010104 I 0.000
ENSONIG00000009252 Oreochromis niloticus ENSONIG00000009252 I 0.000
ENSONIG00000008566 Oreochromis niloticus ENSONIG00000008566 I 0.000
ENSONIG00000006222 Oreochromis niloticus ENSONIG00000006222 I 0.000
ENSONIG00000005828 Oreochromis niloticus ENSONIG00000005828 I 0.000
ENSOGAG00000030317 Otolemur garnettii ENSOGAG00000030317 I 0.000
NR2F6 Otolemur garnettii ENSOGAG00000030281 I 0.000
ENSONIG00000014678 Oreochromis niloticus ENSONIG00000014678 I 0.000
ENSONIG00000017240 Oreochromis niloticus ENSONIG00000017240 I 0.000
NR2C2 Ochotona princeps ENSOPRG00000009351 I 0.000
RORC Oryzias latipes ENSORLG00000009486 I 0.000
NR2F6 Oryzias latipes ENSORLG00000008911 I 0.000
NR2F6 Oryzias latipes ENSORLG00000008749 I 0.000
nr2c1 Oryzias latipes ENSORLG00000004114 I 0.000
nr1h3 Oryzias latipes ENSORLG00000001286 I 0.000
RORB Ochotona princeps ENSOPRG00000016130 I 0.000
NR1H4 Ochotona princeps ENSOPRG00000010997 I 0.000
ENSOPRG00000009918 Ochotona princeps ENSOPRG00000009918 I 0.000
NR1H3 Ochotona princeps ENSOPRG00000009497 I 0.000
NR2C2 Otolemur garnettii ENSOGAG00000014038 I 0.000
NR1H2 Otolemur garnettii ENSOGAG00000012593 I 0.000
NR1H3 Otolemur garnettii ENSOGAG00000012410 I 0.000
ENSOARG00000012659 Ovis aries ENSOARG00000012659 I 0.000
ENSOARG00000005858 Ovis aries ENSOARG00000005858 I 0.000
RORB Ornithorhynchus anatinus ENSOANG00000011655 I 0.000
NR2C2 Ornithorhynchus anatinus ENSOANG00000010886 I 0.000
NR1H3 Ornithorhynchus anatinus ENSOANG00000006250 I 0.000
NR1H4 Ornithorhynchus anatinus ENSOANG00000005583 I 0.000
ENSOANG00000004519 Ornithorhynchus anatinus ENSOANG00000004519 I 0.000
ENSNLEG00000026754 Nomascus leucogenys ENSNLEG00000026754 I 0.000
ENSNLEG00000014458 Nomascus leucogenys ENSNLEG00000014458 I 0.000
ENSOARG00000013898 Ovis aries ENSOARG00000013898 I 0.000
ENSOARG00000013901 Ovis aries ENSOARG00000013901 I 0.000
ENSOARG00000017406 Ovis aries ENSOARG00000017406 I 0.000
NR1H4 Otolemur garnettii ENSOGAG00000007874 I 0.000
RORB Otolemur garnettii ENSOGAG00000001523 I 0.000
NR1H2 Oryctolagus cuniculus ENSOCUG00000027789 I 0.000
ENSOCUG00000023188 Oryctolagus cuniculus ENSOCUG00000023188 I 0.000
NR1H4 Oryctolagus cuniculus ENSOCUG00000007177 I 0.000
NR2C2 Oryctolagus cuniculus ENSOCUG00000006975 I 0.000
RORB Oryctolagus cuniculus ENSOCUG00000003732 I 0.000
NR1H3 Oryctolagus cuniculus ENSOCUG00000002095 I 0.000
ENSOARG00000017630 Ovis aries ENSOARG00000017630 I 0.000
ENSNLEG00000006093 Nomascus leucogenys ENSNLEG00000006093 I 0.000