cassava40986.m1 (Manihot esculenta)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 cassava40986.m1 T333936_2.00 JGI (2012-Mar-17)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.737 0.955
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.955
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.955
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.682
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.682
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
cassava40986.m1 Sox 128 171

Links

Other Sox family TFs
Other Manihot esculenta TFs

532 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
HESX1 Homo sapiens ENSG00000163666 D 0.000
T265_02852 Opisthorchis viverrini T265_02852 I 0.000
BGLB013824 Biomphalaria glabrata BGLB013824 I 0.000
AMAM000848 Anopheles maculatus AMAM000848 I 0.000
ACUA026833 Anopheles culicifacies ACUA026833 I 0.000
LDEC008146 Leptinotarsa decemlineata LDEC008146 I 0.000
CLEC007171 Cimex lectularius CLEC007171 I 0.000
Ogr03859 Ophisaurus gracilis Ogr03859 I 0.000
Gfo_R002825 Geospiza fortis Gfo_R002825 I 0.000
ENSBTAP00000009672-D1 Bos grunniens ENSBTAP00000009672-D1 I 0.000
Aan_R011917 Calypte anna Aan_R011917 I 0.000
ALUE_0001497801 Ascaris lumbricoides ALUE_0001497801 I 0.000
D917_01051 Trichinella nativa D917_01051 I 0.000
T265_00628 Opisthorchis viverrini T265_00628 I 0.000
SROB_0001564301 Schistosoma rodhaini SROB_0001564301 I 0.000
SBAD_0000602401 Soboliphyme baturini SBAD_0000602401 I 0.000
OESDEN_01216 Oesophagostomum dentatum OESDEN_01216 I 0.000
NBR_0000705501 Nippostrongylus brasiliensis NBR_0000705501 I 0.000
L596_g8967 Steinernema carpocapsae L596_g8967 I 0.000
HPLM_0001894101 Haemonchus placei HPLM_0001894101 I 0.000
EVEC_0000357701 Enterobius vermicularis EVEC_0000357701 I 0.000
TELCIR_07728 Teladorsagia circumcincta TELCIR_07728 I 0.000
YQE_10100 Dendroctonus ponderosae YQE_10100 I 0.000
tetur14g02510 Tetranychus urticae tetur14g02510 I 0.000
tetur02g13510 Tetranychus urticae tetur02g13510 I 0.000
ENSLACG00000001487 Latimeria chalumnae ENSLACG00000001487 I 0.000
ENSFCAG00000029037 Felis catus ENSFCAG00000029037 I 0.000
PRRX2 Cavia porcellus ENSCPOG00000021821 I 0.000
DLX3 Bos taurus ENSBTAG00000017409 I 0.000
DLX4 Bos taurus ENSBTAG00000007353 I 0.000
ENSAMEG00000004942 Ailuropoda melanoleuca ENSAMEG00000004942 I 0.000
EFV57629 Trichinella spiralis EFV57629 I 0.000
CGI_10016653 Crassostrea gigas CGI_10016653 I 0.000
CGI_10009720 Crassostrea gigas CGI_10009720 I 0.000
BGIBMGA003233 Bombyx mori BGIBMGA003233 I 0.000
DLX4 Myotis lucifugus ENSMLUG00000007268 I 0.000
meox1 Takifugu rubripes ENSTRUG00000005193 I 0.000
ENSOARG00000005572 Ovis aries ENSOARG00000005572 I 0.000
MCINX008871 Melitaea cinxia MCINX008871 I 0.000
DLX4 Oryctolagus cuniculus ENSOCUG00000022067 I 0.000
L798_06393 Zootermopsis nevadensis L798_06393 I 0.000
GF13343 Drosophila ananassae FBgn0090375 I 0.000
ENSPSIG00000014030 Pelodiscus sinensis ENSPSIG00000014030 I 0.000
ENSTSYG00000014450 Tarsius syrichta ENSTSYG00000014450 I 0.000
ENSTSYG00000000516 Tarsius syrichta ENSTSYG00000000516 I 0.000
ANCCAN_03327 Ancylostoma caninum ANCCAN_03327 N 0.000
DBX1 Procavia capensis ENSPCAG00000004905 N 0.000
HNAJ_0000529701 Hymenolepis nana HNAJ_0000529701 N 0.000
DILT_0000101001 Diphyllobothrium latum DILT_0000101001 N 0.000
DICVIV_04104 Dictyocaulus viviparus DICVIV_04104 N 0.000