mgf007067m (Mimulus guttatus)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 mgf007067m T334286_2.00 JGI (2012-Mar-17)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.707 0.826
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.707 0.826
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.683 0.652
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.653 0.652
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.653 0.652
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.589 0.587
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
mgf007067m Sox 110 155

Links

Other Sox family TFs
Other Mimulus guttatus TFs

520 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
28200.m000191 Ricinus communis 28200.m000191 I 0.654
29631.m001046 Ricinus communis 29631.m001046 I 0.514
29854.m001136 Ricinus communis 29854.m001136 I 0.683
29927.m000626 Ricinus communis 29927.m000626 I 0.653
30174.m008839 Ricinus communis 30174.m008839 I 0.654
30174.m009083 Ricinus communis 30174.m009083 I 0.735
ACEP12759 Atta cephalotes ACEP12759 I 0.420
ACRE_034400 Acremonium chrysogenum ACRE_034400 N 0.419
AFO Arabidopsis lyrata scaffold_403460.1 I 0.683
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.444
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.512
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.683
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.730
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.683
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.683
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.630
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.645
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.683
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.653
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.537
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.696
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.683
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.654
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.573
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.683
Bo3g037630 Brassica oleracea Bo3g037630 I 0.683
Bo3g041840 Brassica oleracea Bo3g041840 I 0.653
Bo4g195410 Brassica oleracea Bo4g195410 I 0.683
Bo5g009010 Brassica oleracea Bo5g009010 I 0.683
Bo5g039580 Brassica oleracea Bo5g039580 I 0.589
Bo6g073320 Brassica oleracea Bo6g073320 I 0.683
Bo6g108630 Brassica oleracea Bo6g108630 I 0.707
Bo7g056180 Brassica oleracea Bo7g056180 I 0.589
Bo8g055830 Brassica oleracea Bo8g055830 I 0.689
Bo8g112450 Brassica oleracea Bo8g112450 I 0.683
Bo9g001130 Brassica oleracea Bo9g001130 I 0.683
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.707
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.589
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.683
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.653
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.683
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.683
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.449
Bra000378 Brassica rapa Bra000378 I 0.683
Bra000538 Brassica rapa Bra000538 I 0.653
Bra003309 Brassica rapa Bra003309 I 0.683
Bra004364 Brassica rapa Bra004364 I 0.707
Bra012373 Brassica rapa Bra012373 I 0.589
Bra018624 Brassica rapa Bra018624 I 0.683
Bra024599 Brassica rapa Bra024599 I 0.589
Bra030728 Brassica rapa Bra030728 I 0.683
Bra031629 Brassica rapa Bra031629 I 0.683
Bra037320 Brassica rapa Bra037320 I 0.683
Bra040322 Brassica rapa Bra040322 I 0.683
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.683
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.439
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.672
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.696
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.654
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.654
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.683
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.654
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.683
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.707
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.633
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.653
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.683
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.683
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.683
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.683
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.633
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.707
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.683
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.653
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.735
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.653
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.653
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.654
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.654
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.633
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.618
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.654
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.653
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.683
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.735
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.683
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.625
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.654
Ca_06681 Cicer arietinum Ca_06681 I 0.653
Ca_07101 Cicer arietinum Ca_07101 I 0.683
Ca_12379 Cicer arietinum Ca_12379 I 0.729
Ca_18533 Cicer arietinum Ca_18533 I 0.735
Ca_21472 Cicer arietinum Ca_21472 I 0.602
Ca_25981 Cicer arietinum Ca_25981 I 0.654
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.630
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.651
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.653
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.654
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.654
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.683
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.613
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.703
Cla000824 Citrullus lanatus Cla000824 I 0.595
Cla005767 Citrullus lanatus Cla005767 I 0.639
Cla008752 Citrullus lanatus Cla008752 I 0.683
Cla010239 Citrullus lanatus Cla010239 I 0.560
Cla010397 Citrullus lanatus Cla010397 I 0.735
Cla011745 Citrullus lanatus Cla011745 I 0.654
Cla012424 Citrullus lanatus Cla012424 I 0.653
Cla016962 Citrullus lanatus Cla016962 I 0.653
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
CND03770 Cryptococcus neoformans CND03770 I 0.460
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.707
CRC Arabidopsis thaliana AT1G69180 D 0.707
CRC Vitis vinifera VIT_01s0011g00140 I 0.735
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.683
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.653
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.735
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.540
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.653
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.654
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.659
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.595
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.449
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.507
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.512
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.440
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.512
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.735
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.633
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.653
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.683
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.654
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.683
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.561
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.735
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.683
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.683
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.654
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.654
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.653
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.589
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
F775_25525 Aegilops tauschii F775_25525 I 0.654
F775_27799 Aegilops tauschii F775_27799 I 0.654
F775_28710 Aegilops tauschii F775_28710 I 0.683
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.453
GB50764 Apis mellifera GB50764 I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.683
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.722
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.653
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.654
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.449
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.523
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.551
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.547
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.600
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.735
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.439
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.654
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.735
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.654
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.439
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.610
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.654
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.601
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.683
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.668
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.683
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.683
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.653
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.683
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.653
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.654
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.668
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.653
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.683
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.654
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.647
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.735
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.683
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.547
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.654
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.653
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.647
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.683
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.654
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.567
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.654
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.683
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.654
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.683
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.696
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.696
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.683
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.683
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.683
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.654
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.654
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.439
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.654
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.654
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.679
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.683
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.683
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.683
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.663
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.660
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.611
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.666
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.690
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.653
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.643
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.685
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.611
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.690
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.673
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.683
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.654
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.673
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.660
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.663
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.654
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.663
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.672
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.509
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.426
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
INO Vitis vinifera VIT_01s0127g00330 I 0.662
INO Arabidopsis thaliana AT1G23420 D 0.589
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.589
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.460
KGM_20190 Danaus plexippus KGM_20190 I 0.416
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.654
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.654
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.696
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.683
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.654
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.683
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.617
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.654
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.654
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.639
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.653
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.683
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.639
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.537
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.619
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.683
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.654
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.735
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
MDOA001488 Musca domestica MDOA001488 I 0.420
MDP0000124879 Malus domestica MDP0000124879 I 0.707
MDP0000126221 Malus domestica MDP0000126221 I 0.630
MDP0000171878 Malus domestica MDP0000171878 I 0.712
MDP0000192940 Malus domestica MDP0000192940 I 0.654
MDP0000252640 Malus domestica MDP0000252640 I 0.683
MDP0000255415 Malus domestica MDP0000255415 I 0.653
MDP0000263713 Malus domestica MDP0000263713 I 0.625
MDP0000291729 Malus domestica MDP0000291729 I 0.707
MDP0000298333 Malus domestica MDP0000298333 I 0.654
MDP0000331808 Malus domestica MDP0000331808 I 0.683
MDP0000366291 Malus domestica MDP0000366291 I 0.683
MDP0000500810 Malus domestica MDP0000500810 I 0.683
mgf001016m Mimulus guttatus mgf001016m I 0.703
mgf003166m Mimulus guttatus mgf003166m I 0.654
mgf009982m Mimulus guttatus mgf009982m I 0.683
mgf010765m Mimulus guttatus mgf010765m I 0.653
mgf011463m Mimulus guttatus mgf011463m I 0.654
mgf015806m Mimulus guttatus mgf015806m I 0.654
mgf015972m Mimulus guttatus mgf015972m I 0.653
mgf019496m Mimulus guttatus mgf019496m I 0.683
mgf023167m Mimulus guttatus mgf023167m I 0.569
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.654
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.683
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.654
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.683
Moror_16065 Moniliophthora roreri Moror_16065 I 0.491
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.683
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.654
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.683
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.654
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.653
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.630
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.453
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
OB02G33040 Oryza brachyantha OB02G33040 I 0.654
OB03G18700 Oryza brachyantha OB03G18700 I 0.696
OB03G35470 Oryza brachyantha OB03G35470 I 0.683
OB04G27010 Oryza brachyantha OB04G27010 I 0.654
OB07G12810 Oryza brachyantha OB07G12810 I 0.683
OB07G25220 Oryza brachyantha OB07G25220 I 0.573
OB12G26050 Oryza brachyantha OB12G26050 I 0.683
OBART02G25670 Oryza barthii OBART02G25670 I 0.654
OBART03G08320 Oryza barthii OBART03G08320 I 0.696
OBART03G27740 Oryza barthii OBART03G27740 I 0.683
OBART04G20010 Oryza barthii OBART04G20010 I 0.654
OBART10G15260 Oryza barthii OBART10G15260 I 0.654
OBART12G19190 Oryza barthii OBART12G19190 I 0.683
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.654
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.696
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.683
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.654
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.654
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.683
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.573
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.696
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.683
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.654
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.654
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.696
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.654
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.683
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.573
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.654
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.683
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.683
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.654
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.696
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.683
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.654
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.654
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.654
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.696
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.683
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.683
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.654
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.683
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.654
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.654
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.653
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.683
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.625
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.680
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.654
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.696
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.654
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.573
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.683
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.654
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.696
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.683
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.654
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.683
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.654
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.683
OS03G0215200 Oryza sativa OS03G0215200 I 0.696
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.654
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.654
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.683
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.683
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.683
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.654
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.654
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.683
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.696
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.696
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.654
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.683
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.696
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.603
PEQ_0000212901 Parascaris equorum PEQ_0000212901 N 0.417
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.463
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.653
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.683
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.683
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.683
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.654
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.731
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.653
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
PK06964.1 Cannabis sativa PK06964.1 I 0.683
PK09461.1 Cannabis sativa PK09461.1 I 0.653
PK13838.1 Cannabis sativa PK13838.1 I 0.735
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.476
Pm001547 Prunus mume Pm001547 I 0.683
Pm006709 Prunus mume Pm006709 I 0.633
Pm017846 Prunus mume Pm017846 I 0.654
Pm023555 Prunus mume Pm023555 I 0.654
Pm027559 Prunus mume Pm027559 I 0.653
Pm030598 Prunus mume Pm030598 I 0.735
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.654
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.654
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.654
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.653
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.702
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.673
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.633
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.722
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.654
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.683
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.653
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.654
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.654
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.683
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.653
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.735
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.633
PV09_07652 Verruconis gallopava PV09_07652 I 0.434
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.462
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.500
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.654
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.653
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.633
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.722
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.696
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.654
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.654
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.683
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.633
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.683
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.654
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.653
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.654
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.654
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.683
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.683
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.654
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.696
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.683
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.654
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.654
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.683
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.468
Si007288m.g Setaria italica Si007288m.g I 0.439
Si010859m.g Setaria italica Si010859m.g I 0.654
Si018146m.g Setaria italica Si018146m.g I 0.654
Si023308m.g Setaria italica Si023308m.g I 0.683
Si030811m.g Setaria italica Si030811m.g I 0.683
Si036788m.g Setaria italica Si036788m.g I 0.654
Si037608m.g Setaria italica Si037608m.g I 0.696
Si037789m.g Setaria italica Si037789m.g I 0.683
SINV12391 Solenopsis invicta SINV12391 I 0.420
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.654
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.568
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.724
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.683
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.653
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.683
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.683
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.653
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.557
sr16632 Sporisorium reilianum sr16632 I 0.430
TCM_005549 Theobroma cacao TCM_005549 I 0.654
TCM_011484 Theobroma cacao TCM_011484 I 0.735
TCM_016030 Theobroma cacao TCM_016030 I 0.654
TCM_031868 Theobroma cacao TCM_031868 I 0.647
TCM_038105 Theobroma cacao TCM_038105 I 0.653
TCM_041175 Theobroma cacao TCM_041175 I 0.683
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.683
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.589
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.683
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.653
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.707
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.683
THITE_22048 Thielavia terrestris THITE_22048 I 0.451
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.654
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.654
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.654
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.605
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.696
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.696
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.696
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.683
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.683
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.683
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.683
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.683
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.683
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.654
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.654
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.654
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.683
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.683
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.654
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.654
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.696
TRIVIDRAFT_16124 Trichoderma virens TRIVIDRAFT_16124 N 0.427
UM06001 Ustilago maydis UM06001 I 0.430
UV8b_7580 Ustilaginoidea virens UV8b_7580 N 0.423
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.654
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.673
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.654
YAB1 Arabidopsis thaliana AT2G45190 D 0.683
YAB1 Oryza sativa OS07G0160100 I 0.683
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.683
YAB2 Arabidopsis thaliana AT1G08465 I 0.683
YAB2 Oryza sativa OS03G0650000 I 0.683
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.683
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.683
YAB3 Oryza sativa OS10G0508300 I 0.654
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.683
YAB3 Arabidopsis thaliana AT4G00180 I 0.683
YAB4 Oryza sativa OS02G0643200 I 0.654
YAB5 Arabidopsis thaliana AT2G26580 D 0.653
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.653
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.653
YAB5 Oryza sativa OS04G0536300 I 0.654
YAB6 Oryza sativa OS12G0621100 I 0.683