Carubv10021641m.g (Capsella rubella)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Carubv10021641m.g T334425_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.741 1.000
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.741 1.000
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.660 0.689
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.630 0.644
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.630 0.644
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.560 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Carubv10021641m Sox 114 158

Links

Other Sox family TFs
Other Capsella rubella TFs

513 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
MDP0000291729 Malus domestica MDP0000291729 I 0.741
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.741
MDP0000124879 Malus domestica MDP0000124879 I 0.741
CRC Arabidopsis thaliana AT1G69180 D 0.741
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.741
Bo6g108630 Brassica oleracea Bo6g108630 I 0.741
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.741
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.741
Bra004364 Brassica rapa Bra004364 I 0.741
MDP0000171878 Malus domestica MDP0000171878 I 0.735
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.712
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.712
Pm030598 Prunus mume Pm030598 I 0.712
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.712
Ca_18533 Cicer arietinum Ca_18533 I 0.712
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.712
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.712
TCM_011484 Theobroma cacao TCM_011484 I 0.712
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.712
CRC Vitis vinifera VIT_01s0011g00140 I 0.712
Cla010397 Citrullus lanatus Cla010397 I 0.712
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.712
PK13838.1 Cannabis sativa PK13838.1 I 0.712
30174.m009083 Ricinus communis 30174.m009083 I 0.712
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.712
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.712
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.712
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.708
mgf007067m Mimulus guttatus mgf007067m I 0.707
Ca_12379 Cicer arietinum Ca_12379 I 0.706
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.701
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.700
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.700
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.699
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.695
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.694
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.689
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.689
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.689
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.689
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.689
OB04G27010 Oryza brachyantha OB04G27010 I 0.689
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.689
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.689
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.689
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.689
Si010859m.g Setaria italica Si010859m.g I 0.689
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.689
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.689
OBART04G20010 Oryza barthii OBART04G20010 I 0.689
Si018146m.g Setaria italica Si018146m.g I 0.689
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.689
Si036788m.g Setaria italica Si036788m.g I 0.689
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.689
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.689
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.689
OBART02G25670 Oryza barthii OBART02G25670 I 0.689
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.689
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.689
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.689
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.689
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.689
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.689
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.689
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.689
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.689
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.689
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.689
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.689
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.689
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.689
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.689
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.689
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.689
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.689
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.689
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.689
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.689
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.689
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.689
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.689
YAB3 Oryza sativa OS10G0508300 I 0.689
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.689
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.689
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.689
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.689
OB02G33040 Oryza brachyantha OB02G33040 I 0.689
YAB5 Oryza sativa OS04G0536300 I 0.689
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.689
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.689
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.689
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.689
YAB4 Oryza sativa OS02G0643200 I 0.689
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.689
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.689
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.689
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.689
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.689
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.689
mgf003166m Mimulus guttatus mgf003166m I 0.689
mgf011463m Mimulus guttatus mgf011463m I 0.689
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.689
mgf015806m Mimulus guttatus mgf015806m I 0.689
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.689
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.689
28200.m000191 Ricinus communis 28200.m000191 I 0.689
Pm023555 Prunus mume Pm023555 I 0.689
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.689
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.689
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.689
30174.m008839 Ricinus communis 30174.m008839 I 0.689
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.689
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.689
MDP0000298333 Malus domestica MDP0000298333 I 0.689
MDP0000192940 Malus domestica MDP0000192940 I 0.689
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.689
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.689
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.689
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.689
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.689
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.689
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.689
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.689
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.689
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.689
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.689
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.689
Pm017846 Prunus mume Pm017846 I 0.689
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.689
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.689
OBART10G15260 Oryza barthii OBART10G15260 I 0.689
Cla011745 Citrullus lanatus Cla011745 I 0.689
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.689
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.689
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.689
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.689
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.689
TCM_005549 Theobroma cacao TCM_005549 I 0.689
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.689
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.689
TCM_016030 Theobroma cacao TCM_016030 I 0.689
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.689
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.689
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.689
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.689
Ca_25981 Cicer arietinum Ca_25981 I 0.689
F775_27799 Aegilops tauschii F775_27799 I 0.689
F775_25525 Aegilops tauschii F775_25525 I 0.689
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.689
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.689
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.689
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.689
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.683
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.680
mgf001016m Mimulus guttatus mgf001016m I 0.680
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.673
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.673
OS03G0215200 Oryza sativa OS03G0215200 I 0.673
Si037608m.g Setaria italica Si037608m.g I 0.673
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.673
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.673
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.673
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.673
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.673
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.673
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.673
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.673
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.673
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.673
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.673
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.673
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.673
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.673
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.673
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.673
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.673
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.673
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.673
OBART03G08320 Oryza barthii OBART03G08320 I 0.673
OB03G18700 Oryza brachyantha OB03G18700 I 0.673
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.668
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.667
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.667
Bo8g055830 Brassica oleracea Bo8g055830 I 0.667
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.663
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.661
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.661
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.660
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.660
YAB2 Arabidopsis thaliana AT1G08465 I 0.660
Pm001547 Prunus mume Pm001547 I 0.660
Bra003309 Brassica rapa Bra003309 I 0.660
Bra000378 Brassica rapa Bra000378 I 0.660
29854.m001136 Ricinus communis 29854.m001136 I 0.660
Bra040322 Brassica rapa Bra040322 I 0.660
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.660
Bra030728 Brassica rapa Bra030728 I 0.660
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.660
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.660
Bra031629 Brassica rapa Bra031629 I 0.660
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.660
Bra037320 Brassica rapa Bra037320 I 0.660
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.660
Bra018624 Brassica rapa Bra018624 I 0.660
AFO Arabidopsis lyrata scaffold_403460.1 I 0.660
MDP0000252640 Malus domestica MDP0000252640 I 0.660
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.660
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.660
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.660
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.660
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.660
TCM_041175 Theobroma cacao TCM_041175 I 0.660
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.660
YAB3 Arabidopsis thaliana AT4G00180 I 0.660
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.660
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.660
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.660
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.660
PK06964.1 Cannabis sativa PK06964.1 I 0.660
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.660
Cla008752 Citrullus lanatus Cla008752 I 0.660
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.660
Si030811m.g Setaria italica Si030811m.g I 0.660
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.660
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.660
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.660
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.660
Ca_07101 Cicer arietinum Ca_07101 I 0.660
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.660
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.660
Bo6g073320 Brassica oleracea Bo6g073320 I 0.660
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.660
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.660
YAB1 Arabidopsis thaliana AT2G45190 D 0.660
Bo5g009010 Brassica oleracea Bo5g009010 I 0.660
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.660
mgf009982m Mimulus guttatus mgf009982m I 0.660
OB07G12810 Oryza brachyantha OB07G12810 I 0.660
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.660
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.660
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.660
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.660
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.660
Bo4g195410 Brassica oleracea Bo4g195410 I 0.660
Bo3g037630 Brassica oleracea Bo3g037630 I 0.660
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.660
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.660
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.660
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.660
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.660
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.660
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.660
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.660
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.660
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.660
MDP0000500810 Malus domestica MDP0000500810 I 0.660
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.660
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.660
Bo8g112450 Brassica oleracea Bo8g112450 I 0.660
YAB1 Oryza sativa OS07G0160100 I 0.660
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.660
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.660
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.660
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.660
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.660
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.660
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.660
Bo9g001130 Brassica oleracea Bo9g001130 I 0.660
mgf019496m Mimulus guttatus mgf019496m I 0.660
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.660
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.660
MDP0000331808 Malus domestica MDP0000331808 I 0.660
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.660
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.660
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.660
MDP0000366291 Malus domestica MDP0000366291 I 0.660
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.660
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.660
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.657
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.657
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.656
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.655
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.654
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.654
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.654
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.654
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.654
F775_28710 Aegilops tauschii F775_28710 I 0.654
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.654
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.654
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.654
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.654
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.654
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.654
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.654
OBART12G19190 Oryza barthii OBART12G19190 I 0.654
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.654
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.654
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.654
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.654
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.654
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.654
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.654
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.654
Si037789m.g Setaria italica Si037789m.g I 0.654
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.654
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.654
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.654
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.654
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.654
Si023308m.g Setaria italica Si023308m.g I 0.654
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.654
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.654
YAB2 Oryza sativa OS03G0650000 I 0.654
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.654
OB12G26050 Oryza brachyantha OB12G26050 I 0.654
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.654
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.654
OBART03G27740 Oryza barthii OBART03G27740 I 0.654
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.654
YAB6 Oryza sativa OS12G0621100 I 0.654
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.654
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.654
OB03G35470 Oryza brachyantha OB03G35470 I 0.654
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.654
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.654
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.654
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.654
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.651
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.650
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.650
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.650
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.644
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.644
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.640
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.640
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.637
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.637
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.637
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.634
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.634
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.634
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.634
INO Vitis vinifera VIT_01s0127g00330 I 0.634
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.630
mgf015972m Mimulus guttatus mgf015972m I 0.630
Bra000538 Brassica rapa Bra000538 I 0.630
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.630
mgf010765m Mimulus guttatus mgf010765m I 0.630
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.630
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.630
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.630
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.630
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.630
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.630
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.630
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.630
Bo3g041840 Brassica oleracea Bo3g041840 I 0.630
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.630
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.630
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.630
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.630
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.630
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.630
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.630
YAB5 Arabidopsis thaliana AT2G26580 D 0.630
29927.m000626 Ricinus communis 29927.m000626 I 0.630
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.630
Pm027559 Prunus mume Pm027559 I 0.630
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.630
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.630
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.630
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.630
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.630
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.630
PK09461.1 Cannabis sativa PK09461.1 I 0.630
Ca_06681 Cicer arietinum Ca_06681 I 0.630
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.630
Cla012424 Citrullus lanatus Cla012424 I 0.630
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.630
Cla016962 Citrullus lanatus Cla016962 I 0.630
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.630
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.630
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.630
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.630
TCM_038105 Theobroma cacao TCM_038105 I 0.630
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.630
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.630
MDP0000255415 Malus domestica MDP0000255415 I 0.630
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.630
Ca_21472 Cicer arietinum Ca_21472 I 0.625
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.624
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.624
TCM_031868 Theobroma cacao TCM_031868 I 0.624
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.622
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.621
Cla005767 Citrullus lanatus Cla005767 I 0.616
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.607
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.604
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.604
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.604
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.604
Pm006709 Prunus mume Pm006709 I 0.604
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.604
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.604
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.604
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.604
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.604
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.604
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.604
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.596
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.596
MDP0000263713 Malus domestica MDP0000263713 I 0.596
MDP0000126221 Malus domestica MDP0000126221 I 0.596
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.596
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.596
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.590
Cla010239 Citrullus lanatus Cla010239 I 0.589
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.585
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.585
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.583
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.582
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.582
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.580
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.569
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.566
Cla000824 Citrullus lanatus Cla000824 I 0.566
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.566
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.565
INO Arabidopsis thaliana AT1G23420 D 0.560
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.560
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.560
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.560
Bra024599 Brassica rapa Bra024599 I 0.560
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.560
Bo7g056180 Brassica oleracea Bo7g056180 I 0.560
Bra012373 Brassica rapa Bra012373 I 0.560
Bo5g039580 Brassica oleracea Bo5g039580 I 0.560
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.560
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.557
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.551
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.547
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.544
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.541
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.541
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.539
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.539
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.539
OB07G25220 Oryza brachyantha OB07G25220 I 0.538
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.538
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.537
mgf023167m Mimulus guttatus mgf023167m I 0.534
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.534
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.533
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.532
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.532
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.532
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.524
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.523
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
Moror_16065 Moniliophthora roreri Moror_16065 I 0.514
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.509
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.507
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.506
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.502
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.500
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.489
29631.m001046 Ricinus communis 29631.m001046 I 0.485
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.462
CND03770 Cryptococcus neoformans CND03770 I 0.460
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.449
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.449
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.443
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.441
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.440
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.440
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.438
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.434
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
UHOR_08529 Ustilago hordei UHOR_08529 I 0.430
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.430
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.430
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.426
scaffold_600397.1 Arabidopsis lyrata scaffold_600397.1 I 0.426
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.425
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.425
THITE_22048 Thielavia terrestris THITE_22048 I 0.422
ACEP12759 Atta cephalotes ACEP12759 I 0.420
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
MDOA001488 Musca domestica MDOA001488 I 0.420
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GB50764 Apis mellifera GB50764 I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.420
PEQ_0000291001 Parascaris equorum PEQ_0000291001 I 0.419
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.419
MAC_01687 Metarhizium acridum MAC_01687 I 0.419
0600010013 Ostreococcus tauri 0600010013 I 0.417
KGM_20190 Danaus plexippus KGM_20190 I 0.416
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416