Gorai.007G089700 (Gossypium raimondii)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Gorai.007G089700 T334544_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.598 0.683
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.564 0.633
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.564 0.633
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.524 0.500
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.524 0.500
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.496 0.517
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Gorai.007G089700.1 Sox 130 189

Links

Other Sox family TFs
Other Gossypium raimondii TFs

464 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AFO Arabidopsis lyrata scaffold_403460.1 I 0.598
Bra003309 Brassica rapa Bra003309 I 0.598
Bra018624 Brassica rapa Bra018624 I 0.598
Bra030728 Brassica rapa Bra030728 I 0.598
Bo9g001130 Brassica oleracea Bo9g001130 I 0.598
Bo8g112450 Brassica oleracea Bo8g112450 I 0.598
Bo5g009010 Brassica oleracea Bo5g009010 I 0.598
Bo6g073320 Brassica oleracea Bo6g073320 I 0.598
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.598
Bra031629 Brassica rapa Bra031629 I 0.598
Bra037320 Brassica rapa Bra037320 I 0.598
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.598
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.598
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.598
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.598
MDP0000500810 Malus domestica MDP0000500810 I 0.598
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.598
Bra040322 Brassica rapa Bra040322 I 0.598
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.598
MDP0000366291 Malus domestica MDP0000366291 I 0.598
Bo4g195410 Brassica oleracea Bo4g195410 I 0.598
Bra000378 Brassica rapa Bra000378 I 0.598
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.598
YAB3 Arabidopsis thaliana AT4G00180 I 0.598
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.598
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.598
YAB1 Arabidopsis thaliana AT2G45190 D 0.598
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.598
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.598
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.598
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.598
Bo3g037630 Brassica oleracea Bo3g037630 I 0.598
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.593
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.593
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.593
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.593
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.593
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.593
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.593
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.593
TCM_041175 Theobroma cacao TCM_041175 I 0.593
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.593
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.593
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.593
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.593
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.593
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.593
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.593
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.593
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.593
MDP0000252640 Malus domestica MDP0000252640 I 0.593
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.593
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.593
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.593
YAB1 Oryza sativa OS07G0160100 I 0.593
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.593
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.593
MDP0000331808 Malus domestica MDP0000331808 I 0.593
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.593
Si030811m.g Setaria italica Si030811m.g I 0.593
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.593
OB07G12810 Oryza brachyantha OB07G12810 I 0.593
PK06964.1 Cannabis sativa PK06964.1 I 0.593
Ca_07101 Cicer arietinum Ca_07101 I 0.593
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.593
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.593
YAB2 Arabidopsis thaliana AT1G08465 I 0.593
Cla008752 Citrullus lanatus Cla008752 I 0.593
Pm001547 Prunus mume Pm001547 I 0.593
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.593
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.593
29854.m001136 Ricinus communis 29854.m001136 I 0.593
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.593
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.593
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.593
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.593
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.593
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.593
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.593
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.593
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.593
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.593
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.593
Bo8g055830 Brassica oleracea Bo8g055830 I 0.592
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.587
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.587
OB03G35470 Oryza brachyantha OB03G35470 I 0.587
YAB6 Oryza sativa OS12G0621100 I 0.587
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.587
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.587
OBART12G19190 Oryza barthii OBART12G19190 I 0.587
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.587
OBART03G27740 Oryza barthii OBART03G27740 I 0.587
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.587
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.587
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.587
YAB2 Oryza sativa OS03G0650000 I 0.587
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.587
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.587
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.587
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.587
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.587
OB12G26050 Oryza brachyantha OB12G26050 I 0.587
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.587
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.587
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.587
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.587
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.587
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.587
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.587
Si023308m.g Setaria italica Si023308m.g I 0.587
Si037789m.g Setaria italica Si037789m.g I 0.587
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.587
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.587
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.587
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.587
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.587
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.587
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.587
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.587
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.587
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.587
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.587
F775_28710 Aegilops tauschii F775_28710 I 0.587
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.587
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.587
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.587
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.587
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.583
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.583
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.583
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.583
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.581
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.581
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.581
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.577
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.571
Pm017846 Prunus mume Pm017846 I 0.569
28200.m000191 Ricinus communis 28200.m000191 I 0.569
Ca_25981 Cicer arietinum Ca_25981 I 0.569
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.569
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.569
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.569
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.569
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.569
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.569
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.569
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.569
30174.m008839 Ricinus communis 30174.m008839 I 0.569
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.569
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.569
mgf015806m Mimulus guttatus mgf015806m I 0.569
mgf011463m Mimulus guttatus mgf011463m I 0.569
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.569
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.569
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.569
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.569
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.569
YAB3 Oryza sativa OS10G0508300 I 0.569
Si036788m.g Setaria italica Si036788m.g I 0.569
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.569
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.569
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.569
TCM_005549 Theobroma cacao TCM_005549 I 0.569
YAB4 Oryza sativa OS02G0643200 I 0.569
mgf003166m Mimulus guttatus mgf003166m I 0.569
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.569
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.569
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.569
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.569
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.569
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.569
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.569
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.569
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.569
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.569
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.569
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.569
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.569
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.569
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.569
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.569
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.569
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.569
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.569
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.569
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.569
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.569
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.569
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.569
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.569
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.569
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.569
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.569
OBART02G25670 Oryza barthii OBART02G25670 I 0.569
OBART10G15260 Oryza barthii OBART10G15260 I 0.569
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.569
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.569
OB02G33040 Oryza brachyantha OB02G33040 I 0.569
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.569
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.569
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.569
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.566
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.566
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.565
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.565
MDP0000192940 Malus domestica MDP0000192940 I 0.565
Cla011745 Citrullus lanatus Cla011745 I 0.565
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.565
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.565
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.565
MDP0000298333 Malus domestica MDP0000298333 I 0.565
Pm023555 Prunus mume Pm023555 I 0.565
TCM_038105 Theobroma cacao TCM_038105 I 0.564
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.564
Cla012424 Citrullus lanatus Cla012424 I 0.564
Ca_06681 Cicer arietinum Ca_06681 I 0.564
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.564
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.564
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.564
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.564
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.564
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.564
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.564
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.564
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.564
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.564
Bo3g041840 Brassica oleracea Bo3g041840 I 0.564
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.564
Bra000538 Brassica rapa Bra000538 I 0.564
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.564
PK09461.1 Cannabis sativa PK09461.1 I 0.564
YAB5 Arabidopsis thaliana AT2G26580 D 0.564
29927.m000626 Ricinus communis 29927.m000626 I 0.564
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.564
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.564
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.564
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.564
mgf015972m Mimulus guttatus mgf015972m I 0.564
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.564
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.564
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.564
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.564
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.564
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.564
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.564
mgf010765m Mimulus guttatus mgf010765m I 0.564
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.564
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.564
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.564
Pm027559 Prunus mume Pm027559 I 0.564
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.564
MDP0000255415 Malus domestica MDP0000255415 I 0.564
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.564
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.563
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.560
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.559
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.559
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.559
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.559
mgf019496m Mimulus guttatus mgf019496m I 0.559
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.559
mgf009982m Mimulus guttatus mgf009982m I 0.559
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.557
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.554
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.553
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.552
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.552
Ca_18533 Cicer arietinum Ca_18533 I 0.552
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.552
TCM_011484 Theobroma cacao TCM_011484 I 0.552
Ca_12379 Cicer arietinum Ca_12379 I 0.552
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.552
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.552
Pm030598 Prunus mume Pm030598 I 0.552
Cla010397 Citrullus lanatus Cla010397 I 0.552
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.552
PK13838.1 Cannabis sativa PK13838.1 I 0.552
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.552
CRC Vitis vinifera VIT_01s0011g00140 I 0.552
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.552
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.552
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.552
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.552
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.552
30174.m009083 Ricinus communis 30174.m009083 I 0.552
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.551
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.551
Cla005767 Citrullus lanatus Cla005767 I 0.551
mgf007067m Mimulus guttatus mgf007067m I 0.547
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.546
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.546
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.537
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.535
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.535
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.535
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.535
Si018146m.g Setaria italica Si018146m.g I 0.535
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.535
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.535
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.535
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.535
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.535
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.535
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.535
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.535
TCM_016030 Theobroma cacao TCM_016030 I 0.535
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.535
F775_27799 Aegilops tauschii F775_27799 I 0.535
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.535
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.535
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.535
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.530
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.530
F775_25525 Aegilops tauschii F775_25525 I 0.530
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.530
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.530
YAB5 Oryza sativa OS04G0536300 I 0.530
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.530
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.530
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.530
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.530
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.530
Si010859m.g Setaria italica Si010859m.g I 0.530
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.530
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.530
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.530
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.530
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.530
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.530
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.530
OB04G27010 Oryza brachyantha OB04G27010 I 0.530
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.530
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.530
OBART04G20010 Oryza barthii OBART04G20010 I 0.530
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.529
Cla016962 Citrullus lanatus Cla016962 I 0.529
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.529
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.528
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.526
MDP0000126221 Malus domestica MDP0000126221 I 0.526
MDP0000263713 Malus domestica MDP0000263713 I 0.526
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.526
INO Vitis vinifera VIT_01s0127g00330 I 0.526
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.526
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.526
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.526
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.526
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.526
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.526
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.524
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.524
Bo6g108630 Brassica oleracea Bo6g108630 I 0.524
MDP0000124879 Malus domestica MDP0000124879 I 0.524
Bra004364 Brassica rapa Bra004364 I 0.524
CRC Arabidopsis thaliana AT1G69180 D 0.524
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.524
MDP0000291729 Malus domestica MDP0000291729 I 0.524
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.524
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.524
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.524
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.523
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.523
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.520
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.520
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.520
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.520
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.520
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.520
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.520
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.520
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.520
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.520
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.520
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.520
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.520
OS03G0215200 Oryza sativa OS03G0215200 I 0.520
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.520
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.520
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.520
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.520
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.520
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.520
OB03G18700 Oryza brachyantha OB03G18700 I 0.520
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.520
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.520
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.520
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.520
OBART03G08320 Oryza barthii OBART03G08320 I 0.520
mgf001016m Mimulus guttatus mgf001016m I 0.520
Si037608m.g Setaria italica Si037608m.g I 0.520
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.520
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.520
MDP0000171878 Malus domestica MDP0000171878 I 0.518
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.517
TCM_031868 Theobroma cacao TCM_031868 I 0.517
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.514
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.514
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.514
29631.m001046 Ricinus communis 29631.m001046 I 0.514
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.514
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.514
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.511
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.510
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.507
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.506
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.505
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.500
Ca_21472 Cicer arietinum Ca_21472 I 0.497
Bra012373 Brassica rapa Bra012373 I 0.496
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.496
INO Arabidopsis thaliana AT1G23420 D 0.496
Cla000824 Citrullus lanatus Cla000824 I 0.496
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.496
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.496
Pm006709 Prunus mume Pm006709 I 0.496
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.496
Bra024599 Brassica rapa Bra024599 I 0.496
Bo7g056180 Brassica oleracea Bo7g056180 I 0.496
Bo5g039580 Brassica oleracea Bo5g039580 I 0.496
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.496
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.496
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.496
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.496
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.496
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.496
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.496
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.496
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.496
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.496
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.496
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.490
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.490
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.488
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.487
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.484
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.484
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.481
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.475
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.475
OB07G25220 Oryza brachyantha OB07G25220 I 0.475
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.474
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.474
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.474
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.474
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.474
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.468
Cla010239 Citrullus lanatus Cla010239 I 0.468
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.468
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.468
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.468
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.467
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.467
mgf023167m Mimulus guttatus mgf023167m I 0.464
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.464
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.459
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.459
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.454
PV09_07652 Verruconis gallopava PV09_07652 I 0.446
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.436
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.436
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.430
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.426
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.425