Gorai.007G089700 (Gossypium raimondii)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Gorai.007G089700 T334544_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.598 0.683
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.564 0.633
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.564 0.633
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.524 0.500
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.524 0.500
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.496 0.517
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Gorai.007G089700.1 Sox 130 189

Links

Other Sox family TFs
Other Gossypium raimondii TFs

464 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
BGIOSGA003668 Oryza indica BGIOSGA003668 N 0.000
Pavir.Ea01767 Panicum virgatum Pavir.Ea01767 N 0.000
Traes_4AL_98EA87DFA1 Triticum aestivum Traes_4AL_98EA87DFA1 N 0.000
Si002433m.g Setaria italica Si002433m.g N 0.000
Sb03g011280 Sorghum bicolor Sb03g011280 N 0.000
OPUNC01G18590 Oryza punctata OPUNC01G18590 N 0.000
ONIVA01G20310 Oryza nivara ONIVA01G20310 N 0.000
LPERR01G15780 Leersia perrieri LPERR01G15780 N 0.000
GSMUA_Achr9G21870_001 Musa acuminata GSMUA_Achr9G21870_001 N 0.000
GRMZM2G456960 Zea mays GRMZM2G456960 N 0.000
GRMZM2G301642 Zea mays GRMZM2G301642 N 0.000
BRADI2G13860 Brachypodium distachyon BRADI2G13860 N 0.000
MYBS1 Oryza indica BGIOSGA003670 N 0.000
Pavir.Eb01413 Panicum virgatum Pavir.Eb01413 N 0.000