Gorai.009G367100 (Gossypium raimondii)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Gorai.009G367100 T334549_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.729 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.729 0.886
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.694 0.818
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.624 0.614
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.624 0.614
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.682
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Gorai.009G367100.1 Sox 112 155
Gorai.009G367100.2 Sox 111 154
Gorai.009G367100.3 Sox 112 155
Gorai.009G367100.4 Sox 112 155
Gorai.009G367100.5 Sox 111 154

Links

Other Sox family TFs
Other Gossypium raimondii TFs

518 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.729
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.729
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.729
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.729
mgf015972m Mimulus guttatus mgf015972m I 0.729
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.729
mgf010765m Mimulus guttatus mgf010765m I 0.729
Bo3g041840 Brassica oleracea Bo3g041840 I 0.729
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.729
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.729
PK09461.1 Cannabis sativa PK09461.1 I 0.729
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.729
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.729
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.729
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.729
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.729
Bra000538 Brassica rapa Bra000538 I 0.729
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.729
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.729
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.729
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.729
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.729
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.729
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.729
TCM_038105 Theobroma cacao TCM_038105 I 0.729
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.729
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.729
Ca_06681 Cicer arietinum Ca_06681 I 0.729
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.729
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.729
MDP0000255415 Malus domestica MDP0000255415 I 0.729
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.729
29927.m000626 Ricinus communis 29927.m000626 I 0.729
Pm027559 Prunus mume Pm027559 I 0.729
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.729
YAB5 Arabidopsis thaliana AT2G26580 D 0.729
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.724
Cla012424 Citrullus lanatus Cla012424 I 0.724
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.724
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.724
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.707
TCM_031868 Theobroma cacao TCM_031868 I 0.707
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.705
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.699
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.699
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.699
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.695
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.695
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.695
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.694
Bo6g073320 Brassica oleracea Bo6g073320 I 0.694
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.694
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.694
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.694
AFO Arabidopsis lyrata scaffold_403460.1 I 0.694
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.694
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.694
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.694
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.694
Bo8g055830 Brassica oleracea Bo8g055830 I 0.694
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.694
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.694
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.694
YAB1 Arabidopsis thaliana AT2G45190 D 0.694
MDP0000500810 Malus domestica MDP0000500810 I 0.694
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.694
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.694
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.694
29854.m001136 Ricinus communis 29854.m001136 I 0.694
Ca_07101 Cicer arietinum Ca_07101 I 0.694
MDP0000366291 Malus domestica MDP0000366291 I 0.694
Cla008752 Citrullus lanatus Cla008752 I 0.694
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.694
Bo3g037630 Brassica oleracea Bo3g037630 I 0.694
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.694
OB07G12810 Oryza brachyantha OB07G12810 I 0.694
YAB2 Arabidopsis thaliana AT1G08465 I 0.694
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.694
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.694
Bo4g195410 Brassica oleracea Bo4g195410 I 0.694
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.694
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.694
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.694
Bo5g009010 Brassica oleracea Bo5g009010 I 0.694
YAB3 Arabidopsis thaliana AT4G00180 I 0.694
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.694
Bra031629 Brassica rapa Bra031629 I 0.694
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.694
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.694
MDP0000252640 Malus domestica MDP0000252640 I 0.694
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.694
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.694
PK06964.1 Cannabis sativa PK06964.1 I 0.694
MDP0000331808 Malus domestica MDP0000331808 I 0.694
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.694
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.694
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.694
Bra000378 Brassica rapa Bra000378 I 0.694
Bra003309 Brassica rapa Bra003309 I 0.694
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.694
Bra018624 Brassica rapa Bra018624 I 0.694
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.694
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.694
Bra030728 Brassica rapa Bra030728 I 0.694
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.694
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.694
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.694
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.694
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.694
Bra037320 Brassica rapa Bra037320 I 0.694
Bo8g112450 Brassica oleracea Bo8g112450 I 0.694
TCM_041175 Theobroma cacao TCM_041175 I 0.694
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.694
YAB1 Oryza sativa OS07G0160100 I 0.694
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.694
Si030811m.g Setaria italica Si030811m.g I 0.694
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.694
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.694
Bra040322 Brassica rapa Bra040322 I 0.694
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.694
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.694
Pm001547 Prunus mume Pm001547 I 0.694
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.694
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.694
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.694
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.694
Bo9g001130 Brassica oleracea Bo9g001130 I 0.694
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.694
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.694
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.694
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.694
OB03G35470 Oryza brachyantha OB03G35470 I 0.693
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.693
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.693
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.693
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.693
YAB2 Oryza sativa OS03G0650000 I 0.693
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.693
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.693
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.693
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.693
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.693
YAB6 Oryza sativa OS12G0621100 I 0.693
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.693
OBART12G19190 Oryza barthii OBART12G19190 I 0.693
OBART03G27740 Oryza barthii OBART03G27740 I 0.693
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.693
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.693
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.693
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.693
OB12G26050 Oryza brachyantha OB12G26050 I 0.693
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.693
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.693
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.693
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.693
Si023308m.g Setaria italica Si023308m.g I 0.693
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.693
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.693
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.693
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.693
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.693
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.693
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.693
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.693
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.693
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.693
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.693
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.693
F775_28710 Aegilops tauschii F775_28710 I 0.693
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.693
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.693
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.690
Cla016962 Citrullus lanatus Cla016962 I 0.690
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.689
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.689
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.689
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.689
Si037789m.g Setaria italica Si037789m.g I 0.689
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.689
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.689
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.689
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.689
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.688
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.684
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.680
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.678
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.678
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.674
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.667
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.666
Ca_25981 Cicer arietinum Ca_25981 I 0.666
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.666
YAB4 Oryza sativa OS02G0643200 I 0.666
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.666
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.666
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.666
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.666
TCM_005549 Theobroma cacao TCM_005549 I 0.666
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.666
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.666
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.666
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.666
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.666
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.666
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.666
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.666
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.666
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.666
Si036788m.g Setaria italica Si036788m.g I 0.666
YAB3 Oryza sativa OS10G0508300 I 0.666
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.666
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.666
OB02G33040 Oryza brachyantha OB02G33040 I 0.666
mgf003166m Mimulus guttatus mgf003166m I 0.666
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.666
mgf011463m Mimulus guttatus mgf011463m I 0.666
mgf015806m Mimulus guttatus mgf015806m I 0.666
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.666
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.666
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.666
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.666
MDP0000192940 Malus domestica MDP0000192940 I 0.666
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.666
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.666
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.666
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.666
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.666
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.666
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.666
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.666
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.666
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.666
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.666
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.666
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.666
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.666
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.666
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.666
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.666
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.666
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.666
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.666
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.666
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.666
OBART10G15260 Oryza barthii OBART10G15260 I 0.666
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.666
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.666
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.666
28200.m000191 Ricinus communis 28200.m000191 I 0.666
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.666
30174.m008839 Ricinus communis 30174.m008839 I 0.666
Pm023555 Prunus mume Pm023555 I 0.666
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.666
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.666
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.666
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.666
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.666
Pm017846 Prunus mume Pm017846 I 0.666
Cla011745 Citrullus lanatus Cla011745 I 0.666
OBART02G25670 Oryza barthii OBART02G25670 I 0.666
MDP0000298333 Malus domestica MDP0000298333 I 0.666
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.665
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.665
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.660
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.660
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.660
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.660
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.660
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.660
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.660
mgf019496m Mimulus guttatus mgf019496m I 0.660
mgf009982m Mimulus guttatus mgf009982m I 0.660
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.659
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.653
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.653
Ca_18533 Cicer arietinum Ca_18533 I 0.653
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.653
Cla010397 Citrullus lanatus Cla010397 I 0.653
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.653
CRC Vitis vinifera VIT_01s0011g00140 I 0.653
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.653
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.653
Pm030598 Prunus mume Pm030598 I 0.653
Ca_12379 Cicer arietinum Ca_12379 I 0.653
30174.m009083 Ricinus communis 30174.m009083 I 0.653
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.653
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.653
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.653
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.653
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.653
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.653
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.653
PK13838.1 Cannabis sativa PK13838.1 I 0.653
TCM_011484 Theobroma cacao TCM_011484 I 0.653
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.653
mgf001016m Mimulus guttatus mgf001016m I 0.651
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.647
mgf007067m Mimulus guttatus mgf007067m I 0.647
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.645
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.645
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.644
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.640
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.640
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.640
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.640
Pm006709 Prunus mume Pm006709 I 0.640
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.640
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.640
INO Vitis vinifera VIT_01s0127g00330 I 0.640
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.640
Cla005767 Citrullus lanatus Cla005767 I 0.639
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.636
F775_25525 Aegilops tauschii F775_25525 I 0.636
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.636
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.636
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.634
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.634
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.634
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.632
Cla000824 Citrullus lanatus Cla000824 I 0.632
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.631
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.631
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.631
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.631
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.631
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.631
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.631
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.631
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.631
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.631
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.631
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.631
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.631
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.631
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.631
OB04G27010 Oryza brachyantha OB04G27010 I 0.631
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.631
OBART04G20010 Oryza barthii OBART04G20010 I 0.631
F775_27799 Aegilops tauschii F775_27799 I 0.631
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.631
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.631
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.631
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.631
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.631
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.631
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.631
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.631
Si018146m.g Setaria italica Si018146m.g I 0.631
Si010859m.g Setaria italica Si010859m.g I 0.631
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.631
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.631
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.631
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.631
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.631
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.631
TCM_016030 Theobroma cacao TCM_016030 I 0.631
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.631
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.631
YAB5 Oryza sativa OS04G0536300 I 0.631
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.627
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.627
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.624
CRC Arabidopsis thaliana AT1G69180 D 0.624
MDP0000291729 Malus domestica MDP0000291729 I 0.624
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.624
MDP0000124879 Malus domestica MDP0000124879 I 0.624
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.624
Bo6g108630 Brassica oleracea Bo6g108630 I 0.624
Bra004364 Brassica rapa Bra004364 I 0.624
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.624
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.624
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.621
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.621
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.621
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.621
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.621
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.621
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.621
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.621
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.621
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.621
OBART03G08320 Oryza barthii OBART03G08320 I 0.621
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.621
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.621
OB03G18700 Oryza brachyantha OB03G18700 I 0.621
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.621
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.621
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.621
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.621
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.621
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.621
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.621
OS03G0215200 Oryza sativa OS03G0215200 I 0.621
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.621
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.621
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.621
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.621
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.621
Si037608m.g Setaria italica Si037608m.g I 0.621
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.621
MDP0000171878 Malus domestica MDP0000171878 I 0.618
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.618
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.615
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.614
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.614
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.614
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.614
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.612
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.605
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.604
MDP0000263713 Malus domestica MDP0000263713 I 0.602
MDP0000126221 Malus domestica MDP0000126221 I 0.602
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.602
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.602
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.596
Bo5g039580 Brassica oleracea Bo5g039580 I 0.596
Bra012373 Brassica rapa Bra012373 I 0.596
Bo7g056180 Brassica oleracea Bo7g056180 I 0.596
Bra024599 Brassica rapa Bra024599 I 0.596
INO Arabidopsis thaliana AT1G23420 D 0.596
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.596
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.596
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.596
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.596
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.596
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.596
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.596
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.594
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.588
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.586
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.584
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.584
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.580
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.580
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.575
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.573
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.570
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.570
mgf023167m Mimulus guttatus mgf023167m I 0.570
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.569
OB07G25220 Oryza brachyantha OB07G25220 I 0.568
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.568
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.568
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.568
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.568
Ca_21472 Cicer arietinum Ca_21472 I 0.567
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.567
Cla010239 Citrullus lanatus Cla010239 I 0.567
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.551
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.548
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.541
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.541
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.524
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
Moror_16065 Moniliophthora roreri Moror_16065 I 0.516
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.508
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.507
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
29631.m001046 Ricinus communis 29631.m001046 I 0.485
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.477
PV09_07652 Verruconis gallopava PV09_07652 I 0.474
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.473
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.472
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.466
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.461
CND03770 Cryptococcus neoformans CND03770 I 0.461
sr16632 Sporisorium reilianum sr16632 I 0.458
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.456
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.446
EMIHUDRAFT_117867 Emiliania huxleyi EMIHUDRAFT_117867 I 0.446
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.446
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.440
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.440
mgf012563m Mimulus guttatus mgf012563m I 0.439
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.435
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.435
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.434
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.434
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.434
Si007288m.g Setaria italica Si007288m.g I 0.434
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.431
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.431
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.429
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.429
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.428
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.428
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.427
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.427
CMT447C Cyanidioschyzon merolae CMT447C I 0.426
UM06001 Ustilago maydis UM06001 I 0.424
Hba_16915 Heterorhabditis bacteriophora Hba_16915 I 0.423
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.421
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.421
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.420
MDOA001488 Musca domestica MDOA001488 I 0.420
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.420
GB50764 Apis mellifera GB50764 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.419
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.418
THITE_22048 Thielavia terrestris THITE_22048 I 0.417
ENSCING00000000505 Ciona intestinalis ENSCING00000000505 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.416