Lus10030596.g (Linum usitatissimum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Lus10030596.g T334576_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.538 0.524
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.508 0.508
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.508 0.508
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.502 0.429
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.502 0.429
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.491 0.619
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Lus10030596 Sox 168 230

Links

Other Sox family TFs
Other Linum usitatissimum TFs

461 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
INO Vitis vinifera VIT_01s0127g00330 I 0.569
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.569
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.569
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.564
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.564
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.558
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.554
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.552
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.548
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.548
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.548
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.548
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.547
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.546
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.546
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.544
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.542
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.542
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.542
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.540
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.540
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.540
Pm006709 Prunus mume Pm006709 I 0.540
29631.m001046 Ricinus communis 29631.m001046 I 0.539
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.538
Si023308m.g Setaria italica Si023308m.g I 0.538
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.538
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.538
YAB6 Oryza sativa OS12G0621100 I 0.538
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.538
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.538
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.538
Si037789m.g Setaria italica Si037789m.g I 0.538
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.538
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.538
AFO Arabidopsis lyrata scaffold_403460.1 I 0.538
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.538
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.538
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.538
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.538
OBART03G27740 Oryza barthii OBART03G27740 I 0.538
OB12G26050 Oryza brachyantha OB12G26050 I 0.538
OBART12G19190 Oryza barthii OBART12G19190 I 0.538
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.538
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.538
OB07G12810 Oryza brachyantha OB07G12810 I 0.538
OB03G35470 Oryza brachyantha OB03G35470 I 0.538
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.538
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.538
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.538
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.538
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.538
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.538
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.538
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.538
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.538
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.538
YAB2 Oryza sativa OS03G0650000 I 0.538
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.538
TCM_041175 Theobroma cacao TCM_041175 I 0.538
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.538
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.538
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.538
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.538
YAB1 Oryza sativa OS07G0160100 I 0.538
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.538
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.538
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.538
MDP0000252640 Malus domestica MDP0000252640 I 0.538
MDP0000331808 Malus domestica MDP0000331808 I 0.538
MDP0000366291 Malus domestica MDP0000366291 I 0.538
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.538
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.538
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.538
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.538
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.538
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.538
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.538
MDP0000500810 Malus domestica MDP0000500810 I 0.538
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.538
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.538
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.538
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.538
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.538
PK06964.1 Cannabis sativa PK06964.1 I 0.538
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.538
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.538
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.538
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.538
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.538
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.538
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.538
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.538
Ca_07101 Cicer arietinum Ca_07101 I 0.538
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.538
Cla008752 Citrullus lanatus Cla008752 I 0.538
Pm001547 Prunus mume Pm001547 I 0.538
29854.m001136 Ricinus communis 29854.m001136 I 0.538
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.538
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.538
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.538
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.538
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.538
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.538
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.538
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.538
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.538
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.538
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.538
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.538
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.538
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.538
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.538
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.538
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.538
mgf009982m Mimulus guttatus mgf009982m I 0.538
mgf019496m Mimulus guttatus mgf019496m I 0.538
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.538
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.538
Si030811m.g Setaria italica Si030811m.g I 0.538
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.538
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.538
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.538
Bra040322 Brassica rapa Bra040322 I 0.538
Bra037320 Brassica rapa Bra037320 I 0.538
Bra030728 Brassica rapa Bra030728 I 0.538
Bra031629 Brassica rapa Bra031629 I 0.538
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.538
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.538
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.538
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.538
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.538
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.538
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.538
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.538
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.538
Bra018624 Brassica rapa Bra018624 I 0.538
Bra003309 Brassica rapa Bra003309 I 0.538
YAB1 Arabidopsis thaliana AT2G45190 D 0.538
YAB3 Arabidopsis thaliana AT4G00180 I 0.538
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.538
YAB2 Arabidopsis thaliana AT1G08465 I 0.538
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.538
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.538
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.538
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.538
Bo3g037630 Brassica oleracea Bo3g037630 I 0.538
Bo8g112450 Brassica oleracea Bo8g112450 I 0.538
Bo9g001130 Brassica oleracea Bo9g001130 I 0.538
Bra000378 Brassica rapa Bra000378 I 0.538
Bo8g055830 Brassica oleracea Bo8g055830 I 0.538
Bo6g073320 Brassica oleracea Bo6g073320 I 0.538
Bo4g195410 Brassica oleracea Bo4g195410 I 0.538
Bo5g009010 Brassica oleracea Bo5g009010 I 0.538
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.538
F775_28710 Aegilops tauschii F775_28710 I 0.538
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.538
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.538
mgf007067m Mimulus guttatus mgf007067m I 0.537
MDP0000126221 Malus domestica MDP0000126221 I 0.537
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.537
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.537
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.537
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.537
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.535
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.535
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.535
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.535
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.535
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.533
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.533
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.532
MDP0000263713 Malus domestica MDP0000263713 I 0.532
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.532
CRC Vitis vinifera VIT_01s0011g00140 I 0.531
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.531
Ca_12379 Cicer arietinum Ca_12379 I 0.531
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.531
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.531
Ca_18533 Cicer arietinum Ca_18533 I 0.531
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.531
PK13838.1 Cannabis sativa PK13838.1 I 0.531
TCM_011484 Theobroma cacao TCM_011484 I 0.531
30174.m009083 Ricinus communis 30174.m009083 I 0.531
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.531
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.531
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.531
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.531
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.531
Pm030598 Prunus mume Pm030598 I 0.531
Cla010397 Citrullus lanatus Cla010397 I 0.531
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.531
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.531
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.526
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.525
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.524
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.524
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.518
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.514
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.514
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.513
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.512
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.510
mgf011463m Mimulus guttatus mgf011463m I 0.509
mgf015806m Mimulus guttatus mgf015806m I 0.509
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.509
OBART10G15260 Oryza barthii OBART10G15260 I 0.509
mgf003166m Mimulus guttatus mgf003166m I 0.509
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.509
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.509
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.509
OBART04G20010 Oryza barthii OBART04G20010 I 0.509
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.509
Ca_25981 Cicer arietinum Ca_25981 I 0.509
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.509
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.509
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.509
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.509
OBART02G25670 Oryza barthii OBART02G25670 I 0.509
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.509
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.509
Cla011745 Citrullus lanatus Cla011745 I 0.509
28200.m000191 Ricinus communis 28200.m000191 I 0.509
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.509
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.509
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.509
Pm017846 Prunus mume Pm017846 I 0.509
Pm023555 Prunus mume Pm023555 I 0.509
F775_25525 Aegilops tauschii F775_25525 I 0.509
30174.m008839 Ricinus communis 30174.m008839 I 0.509
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.509
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.509
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.509
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.509
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.509
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.509
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.509
F775_27799 Aegilops tauschii F775_27799 I 0.509
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.509
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.509
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.509
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.509
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.509
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.509
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.509
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.509
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.509
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.509
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.509
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.509
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.509
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.509
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.509
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.509
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.509
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.509
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.509
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.509
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.509
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.509
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.509
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.509
OB02G33040 Oryza brachyantha OB02G33040 I 0.509
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.509
OB04G27010 Oryza brachyantha OB04G27010 I 0.509
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.509
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.509
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.509
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.509
MDP0000298333 Malus domestica MDP0000298333 I 0.509
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.509
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.509
MDP0000192940 Malus domestica MDP0000192940 I 0.509
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.509
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.509
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.509
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.509
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.509
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.509
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.509
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.509
Si036788m.g Setaria italica Si036788m.g I 0.509
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.509
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.509
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.509
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.509
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.509
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.509
Si018146m.g Setaria italica Si018146m.g I 0.509
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.509
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.509
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.509
TCM_005549 Theobroma cacao TCM_005549 I 0.509
YAB5 Oryza sativa OS04G0536300 I 0.509
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.509
TCM_016030 Theobroma cacao TCM_016030 I 0.509
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.509
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.509
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.509
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.509
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.509
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.509
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.509
Si010859m.g Setaria italica Si010859m.g I 0.509
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.509
YAB4 Oryza sativa OS02G0643200 I 0.509
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.509
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.509
YAB3 Oryza sativa OS10G0508300 I 0.509
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.509
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.509
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.509
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.509
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.509
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.509
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.509
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.509
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.509
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.509
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.509
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.508
Bra000538 Brassica rapa Bra000538 I 0.508
MDP0000255415 Malus domestica MDP0000255415 I 0.508
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.508
Bo3g041840 Brassica oleracea Bo3g041840 I 0.508
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.508
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.508
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.508
MDP0000171878 Malus domestica MDP0000171878 I 0.508
YAB5 Arabidopsis thaliana AT2G26580 D 0.508
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.508
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.508
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.508
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.508
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.508
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.508
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.508
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.508
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.508
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.508
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.508
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.508
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.508
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.508
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.508
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.508
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.508
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.508
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.508
mgf015972m Mimulus guttatus mgf015972m I 0.508
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.508
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.508
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.508
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.508
Pm027559 Prunus mume Pm027559 I 0.508
29927.m000626 Ricinus communis 29927.m000626 I 0.508
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.508
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.508
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.508
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.508
PK09461.1 Cannabis sativa PK09461.1 I 0.508
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.508
Cla016962 Citrullus lanatus Cla016962 I 0.508
mgf010765m Mimulus guttatus mgf010765m I 0.508
TCM_031868 Theobroma cacao TCM_031868 I 0.508
TCM_038105 Theobroma cacao TCM_038105 I 0.508
Cla012424 Citrullus lanatus Cla012424 I 0.508
Ca_06681 Cicer arietinum Ca_06681 I 0.508
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.508
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.508
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.504
CRC Arabidopsis thaliana AT1G69180 D 0.502
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.502
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.502
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.502
MDP0000291729 Malus domestica MDP0000291729 I 0.502
Bo6g108630 Brassica oleracea Bo6g108630 I 0.502
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.502
Bra004364 Brassica rapa Bra004364 I 0.502
MDP0000124879 Malus domestica MDP0000124879 I 0.502
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.502
Cla000824 Citrullus lanatus Cla000824 I 0.501
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.501
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.501
mgf001016m Mimulus guttatus mgf001016m I 0.499
OS03G0215200 Oryza sativa OS03G0215200 I 0.498
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.498
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.498
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.498
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.498
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.498
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.498
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.498
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.498
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.498
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.498
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.498
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.498
Ca_21472 Cicer arietinum Ca_21472 I 0.498
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.498
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.498
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.498
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.498
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.498
OBART03G08320 Oryza barthii OBART03G08320 I 0.498
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.498
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.498
OB03G18700 Oryza brachyantha OB03G18700 I 0.498
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.498
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.498
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.498
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.498
Si037608m.g Setaria italica Si037608m.g I 0.498
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.498
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.498
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.492
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.492
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.492
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.492
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.491
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.491
Bo5g039580 Brassica oleracea Bo5g039580 I 0.491
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.491
Bo7g056180 Brassica oleracea Bo7g056180 I 0.491
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.491
Bra012373 Brassica rapa Bra012373 I 0.491
Bra024599 Brassica rapa Bra024599 I 0.491
INO Arabidopsis thaliana AT1G23420 D 0.491
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.491
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.487
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.486
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.484
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.482
Cla005767 Citrullus lanatus Cla005767 I 0.482
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.482
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.475
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.475
mgf023167m Mimulus guttatus mgf023167m I 0.475
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.471
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.468
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.462
Cla010239 Citrullus lanatus Cla010239 I 0.462
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.453
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.453
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.448
OB07G25220 Oryza brachyantha OB07G25220 I 0.448
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.447
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.447
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.447
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.447
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.445
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.443
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.442
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.441
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.441
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.436
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.435
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.435
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.427
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.427
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.424