Lus10030892.g (Linum usitatissimum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Lus10030892.g T334578_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.614 0.725
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.585 0.600
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.585 0.600
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.584 0.700
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.584 0.700
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.800
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Lus10030892 Sox 60 99

Links

Other Sox family TFs
Other Linum usitatissimum TFs

474 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.667
TCM_041175 Theobroma cacao TCM_041175 I 0.667
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.658
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.652
INO Vitis vinifera VIT_01s0127g00330 I 0.645
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.645
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.645
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.641
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.641
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.640
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.634
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.628
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.625
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.625
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.624
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.624
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.623
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.622
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.622
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.621
Cla005767 Citrullus lanatus Cla005767 I 0.621
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.621
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.620
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.620
mgf007067m Mimulus guttatus mgf007067m I 0.619
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.619
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.618
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.618
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.618
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.618
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.618
Pm006709 Prunus mume Pm006709 I 0.616
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.616
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.616
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.616
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.614
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.614
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.614
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.614
Si030811m.g Setaria italica Si030811m.g I 0.614
OB03G35470 Oryza brachyantha OB03G35470 I 0.614
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.614
Si023308m.g Setaria italica Si023308m.g I 0.614
AFO Arabidopsis lyrata scaffold_403460.1 I 0.614
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.614
Si037789m.g Setaria italica Si037789m.g I 0.614
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.614
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.614
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.614
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.614
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.614
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.614
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.614
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.614
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.614
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.614
OBART03G27740 Oryza barthii OBART03G27740 I 0.614
OB12G26050 Oryza brachyantha OB12G26050 I 0.614
OBART12G19190 Oryza barthii OBART12G19190 I 0.614
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.614
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.614
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.614
YAB1 Oryza sativa OS07G0160100 I 0.614
YAB6 Oryza sativa OS12G0621100 I 0.614
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.614
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.614
YAB2 Oryza sativa OS03G0650000 I 0.614
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.614
OB07G12810 Oryza brachyantha OB07G12810 I 0.614
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.614
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.614
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.614
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.614
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.614
MDP0000126221 Malus domestica MDP0000126221 I 0.614
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.614
MDP0000252640 Malus domestica MDP0000252640 I 0.614
MDP0000331808 Malus domestica MDP0000331808 I 0.614
MDP0000366291 Malus domestica MDP0000366291 I 0.614
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.614
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.614
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.614
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.614
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.614
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.614
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.614
MDP0000500810 Malus domestica MDP0000500810 I 0.614
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.614
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.614
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.614
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.614
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.614
PK06964.1 Cannabis sativa PK06964.1 I 0.614
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.614
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.614
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.614
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.614
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.614
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.614
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.614
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.614
Ca_07101 Cicer arietinum Ca_07101 I 0.614
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.614
Cla008752 Citrullus lanatus Cla008752 I 0.614
Pm001547 Prunus mume Pm001547 I 0.614
29854.m001136 Ricinus communis 29854.m001136 I 0.614
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.614
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.614
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.614
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.614
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.614
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.614
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.614
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.614
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.614
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.614
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.614
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.614
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.614
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.614
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.614
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.614
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.614
mgf009982m Mimulus guttatus mgf009982m I 0.614
mgf019496m Mimulus guttatus mgf019496m I 0.614
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.614
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.614
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.614
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.614
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.614
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.614
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.614
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.614
F775_28710 Aegilops tauschii F775_28710 I 0.614
Bo8g112450 Brassica oleracea Bo8g112450 I 0.614
YAB2 Arabidopsis thaliana AT1G08465 I 0.614
Bra003309 Brassica rapa Bra003309 I 0.614
Bra000378 Brassica rapa Bra000378 I 0.614
Bo9g001130 Brassica oleracea Bo9g001130 I 0.614
YAB1 Arabidopsis thaliana AT2G45190 D 0.614
Bo8g055830 Brassica oleracea Bo8g055830 I 0.614
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.614
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.614
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.614
Bo4g195410 Brassica oleracea Bo4g195410 I 0.614
Bo5g009010 Brassica oleracea Bo5g009010 I 0.614
Bo6g073320 Brassica oleracea Bo6g073320 I 0.614
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.614
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.614
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.614
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.614
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.614
Bo3g037630 Brassica oleracea Bo3g037630 I 0.614
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.614
YAB3 Arabidopsis thaliana AT4G00180 I 0.614
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.614
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.614
Bra018624 Brassica rapa Bra018624 I 0.614
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.614
Bra031629 Brassica rapa Bra031629 I 0.614
Bra030728 Brassica rapa Bra030728 I 0.614
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.614
Bra037320 Brassica rapa Bra037320 I 0.614
Bra040322 Brassica rapa Bra040322 I 0.614
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.614
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.614
Ca_12379 Cicer arietinum Ca_12379 I 0.613
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.613
Pm030598 Prunus mume Pm030598 I 0.613
Cla010397 Citrullus lanatus Cla010397 I 0.613
PK13838.1 Cannabis sativa PK13838.1 I 0.613
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.613
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.613
TCM_011484 Theobroma cacao TCM_011484 I 0.613
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.613
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.613
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.613
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.613
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.613
CRC Vitis vinifera VIT_01s0011g00140 I 0.613
Ca_18533 Cicer arietinum Ca_18533 I 0.613
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.613
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.613
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.613
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.613
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.613
30174.m009083 Ricinus communis 30174.m009083 I 0.613
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.611
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.611
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.611
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.609
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.609
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.608
MDP0000263713 Malus domestica MDP0000263713 I 0.608
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.608
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.607
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.607
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.607
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.603
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.601
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.596
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.594
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.593
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.592
MDP0000171878 Malus domestica MDP0000171878 I 0.591
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.587
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.585
Bo6g108630 Brassica oleracea Bo6g108630 I 0.585
Pm017846 Prunus mume Pm017846 I 0.585
Pm023555 Prunus mume Pm023555 I 0.585
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.585
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.585
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.585
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.585
TCM_016030 Theobroma cacao TCM_016030 I 0.585
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.585
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.585
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.585
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.585
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.585
28200.m000191 Ricinus communis 28200.m000191 I 0.585
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.585
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.585
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.585
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.585
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.585
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.585
Bra004364 Brassica rapa Bra004364 I 0.585
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.585
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.585
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.585
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.585
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.585
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.585
Ca_25981 Cicer arietinum Ca_25981 I 0.585
30174.m008839 Ricinus communis 30174.m008839 I 0.585
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.585
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.585
mgf015806m Mimulus guttatus mgf015806m I 0.585
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.585
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.585
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.585
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.585
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.585
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.585
F775_27799 Aegilops tauschii F775_27799 I 0.585
F775_25525 Aegilops tauschii F775_25525 I 0.585
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.585
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.585
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.585
Cla011745 Citrullus lanatus Cla011745 I 0.585
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.585
mgf003166m Mimulus guttatus mgf003166m I 0.585
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.585
mgf011463m Mimulus guttatus mgf011463m I 0.585
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.585
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.585
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.585
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.585
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.585
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.585
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.585
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.585
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.585
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.585
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.585
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.585
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.585
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.585
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.585
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.585
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.585
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.585
CRC Arabidopsis thaliana AT1G69180 D 0.585
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.585
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.585
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.585
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.585
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.585
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.585
OB02G33040 Oryza brachyantha OB02G33040 I 0.585
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.585
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.585
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.585
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.585
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.585
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.585
OB04G27010 Oryza brachyantha OB04G27010 I 0.585
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.585
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.585
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.585
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.585
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.585
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.585
OBART02G25670 Oryza barthii OBART02G25670 I 0.585
OBART04G20010 Oryza barthii OBART04G20010 I 0.585
OBART10G15260 Oryza barthii OBART10G15260 I 0.585
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.585
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.585
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.585
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.585
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.585
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.585
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.585
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.585
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.585
MDP0000298333 Malus domestica MDP0000298333 I 0.585
MDP0000291729 Malus domestica MDP0000291729 I 0.585
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.585
MDP0000192940 Malus domestica MDP0000192940 I 0.585
MDP0000124879 Malus domestica MDP0000124879 I 0.585
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.585
TCM_005549 Theobroma cacao TCM_005549 I 0.585
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.585
Si036788m.g Setaria italica Si036788m.g I 0.585
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.585
Si010859m.g Setaria italica Si010859m.g I 0.585
Si018146m.g Setaria italica Si018146m.g I 0.585
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.585
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.585
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.585
YAB3 Oryza sativa OS10G0508300 I 0.585
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.585
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.585
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.585
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.585
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.585
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.585
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.585
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.585
YAB4 Oryza sativa OS02G0643200 I 0.585
YAB5 Oryza sativa OS04G0536300 I 0.585
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.585
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.584
YAB5 Arabidopsis thaliana AT2G26580 D 0.584
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.584
Bo3g041840 Brassica oleracea Bo3g041840 I 0.584
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.584
PK09461.1 Cannabis sativa PK09461.1 I 0.584
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.584
MDP0000255415 Malus domestica MDP0000255415 I 0.584
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.584
Bra000538 Brassica rapa Bra000538 I 0.584
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.584
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.584
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.584
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.584
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.584
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.584
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.584
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.584
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.584
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.584
Cla016962 Citrullus lanatus Cla016962 I 0.584
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.584
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.584
TCM_038105 Theobroma cacao TCM_038105 I 0.584
TCM_031868 Theobroma cacao TCM_031868 I 0.584
Ca_06681 Cicer arietinum Ca_06681 I 0.584
Cla012424 Citrullus lanatus Cla012424 I 0.584
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.584
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.584
29927.m000626 Ricinus communis 29927.m000626 I 0.584
Pm027559 Prunus mume Pm027559 I 0.584
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.584
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.584
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.584
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.584
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.584
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.584
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.584
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.584
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.584
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.584
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.584
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.584
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.584
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.584
mgf015972m Mimulus guttatus mgf015972m I 0.584
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.584
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.584
mgf001016m Mimulus guttatus mgf001016m I 0.584
mgf010765m Mimulus guttatus mgf010765m I 0.584
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.581
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.581
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.581
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.581
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.581
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.581
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.581
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.581
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.581
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.581
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.581
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.581
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.581
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.581
OB03G18700 Oryza brachyantha OB03G18700 I 0.581
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.581
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.581
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.581
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.581
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.581
OS03G0215200 Oryza sativa OS03G0215200 I 0.581
OBART03G08320 Oryza barthii OBART03G08320 I 0.581
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.581
Si037608m.g Setaria italica Si037608m.g I 0.581
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.581
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.581
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.581
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.581
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.581
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.578
Cla000824 Citrullus lanatus Cla000824 I 0.578
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.577
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.575
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.575
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.575
Ca_21472 Cicer arietinum Ca_21472 I 0.574
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.571
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.568
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.567
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.567
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.567
Bo7g056180 Brassica oleracea Bo7g056180 I 0.567
Bo5g039580 Brassica oleracea Bo5g039580 I 0.567
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.567
Bra012373 Brassica rapa Bra012373 I 0.567
INO Arabidopsis thaliana AT1G23420 D 0.567
Bra024599 Brassica rapa Bra024599 I 0.567
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.567
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.565
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.562
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.560
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.558
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.558
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.554
mgf023167m Mimulus guttatus mgf023167m I 0.551
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.547
Cla010239 Citrullus lanatus Cla010239 I 0.538
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.530
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.530
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.524
OB07G25220 Oryza brachyantha OB07G25220 I 0.524
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.523
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.523
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.523
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.521
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.521
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.519
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.519
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.517
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.512
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.511
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.511
29631.m001046 Ricinus communis 29631.m001046 I 0.497
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.487
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.487
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.487
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.484
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.483
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.481
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.466
PEQ_0000212901 Parascaris equorum PEQ_0000212901 N 0.464
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.457
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.451
Moror_16065 Moniliophthora roreri Moror_16065 I 0.450
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.445
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.440
CND03770 Cryptococcus neoformans CND03770 I 0.439
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.436
23225_YPR052C Saccharomyces paradoxus 23225_YPR052C I 0.424
H101_08199 Trichophyton interdigitale H101_08199 N 0.418
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.418