MDP0000255415 (Malus domestica)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 MDP0000255415 T334605_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.741 1.000
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.741 1.000
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.707 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.630 0.659
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.630 0.659
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
MDP0000255415 Sox 113 156

Links

Other Sox family TFs
Other Malus domestica TFs

531 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
YAB1 Arabidopsis thaliana AT2G45190 D 0.707
INO Arabidopsis thaliana AT1G23420 D 0.596
CRC Arabidopsis thaliana AT1G69180 D 0.630
YAB5 Arabidopsis thaliana AT2G26580 D 0.741
Ca_12379 Cicer arietinum Ca_12379 I 0.659
28200.m000191 Ricinus communis 28200.m000191 I 0.678
Pm030598 Prunus mume Pm030598 I 0.659
Pm027559 Prunus mume Pm027559 I 0.741
Pm023555 Prunus mume Pm023555 I 0.678
29631.m001046 Ricinus communis 29631.m001046 I 0.485
29854.m001136 Ricinus communis 29854.m001136 I 0.707
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.672
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.678
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.741
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.741
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.659
30174.m009083 Ricinus communis 30174.m009083 I 0.659
30174.m008839 Ricinus communis 30174.m008839 I 0.678
29927.m000626 Ricinus communis 29927.m000626 I 0.741
Pm017846 Prunus mume Pm017846 I 0.678
Pm006709 Prunus mume Pm006709 I 0.640
Ca_18533 Cicer arietinum Ca_18533 I 0.659
Ca_21472 Cicer arietinum Ca_21472 I 0.573
Ca_25981 Cicer arietinum Ca_25981 I 0.678
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.427
Cla000824 Citrullus lanatus Cla000824 I 0.631
Cla005767 Citrullus lanatus Cla005767 I 0.651
Cla008752 Citrullus lanatus Cla008752 I 0.707
Cla010239 Citrullus lanatus Cla010239 I 0.567
Cla010397 Citrullus lanatus Cla010397 I 0.659
Cla011745 Citrullus lanatus Cla011745 I 0.678
Cla012424 Citrullus lanatus Cla012424 I 0.737
Cla016962 Citrullus lanatus Cla016962 I 0.702
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.420
Pm001547 Prunus mume Pm001547 I 0.707
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.644
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.596
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.678
mgf003166m Mimulus guttatus mgf003166m I 0.678
mgf007067m Mimulus guttatus mgf007067m I 0.653
mgf009982m Mimulus guttatus mgf009982m I 0.673
mgf010765m Mimulus guttatus mgf010765m I 0.741
mgf011463m Mimulus guttatus mgf011463m I 0.678
mgf012563m Mimulus guttatus mgf012563m I 0.439
mgf015806m Mimulus guttatus mgf015806m I 0.678
mgf015972m Mimulus guttatus mgf015972m I 0.741
mgf019496m Mimulus guttatus mgf019496m I 0.673
mgf023167m Mimulus guttatus mgf023167m I 0.569
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.416
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.576
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.707
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.741
mgf001016m Mimulus guttatus mgf001016m I 0.657
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.567
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.741
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.707
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.659
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.707
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.602
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.678
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.707
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.702
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.659
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.547
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.737
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.678
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.678
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.631
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.589
Ca_07101 Cicer arietinum Ca_07101 I 0.707
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.678
SINV12391 Solenopsis invicta SINV12391 I 0.420
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.678
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.570
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.659
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.707
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.741
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.707
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.707
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.701
sr16632 Sporisorium reilianum sr16632 I 0.464
TCM_005549 Theobroma cacao TCM_005549 I 0.678
TCM_011484 Theobroma cacao TCM_011484 I 0.659
TCM_016030 Theobroma cacao TCM_016030 I 0.644
TCM_031868 Theobroma cacao TCM_031868 I 0.695
Si037789m.g Setaria italica Si037789m.g I 0.701
Si037608m.g Setaria italica Si037608m.g I 0.627
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.627
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.707
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.644
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.644
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.706
AFO Arabidopsis lyrata scaffold_403460.1 I 0.707
SCLCIDRAFT_19032 Scleroderma citrinum SCLCIDRAFT_19032 I 0.427
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.434
Si007288m.g Setaria italica Si007288m.g I 0.433
Si010859m.g Setaria italica Si010859m.g I 0.644
Si018146m.g Setaria italica Si018146m.g I 0.644
Si023308m.g Setaria italica Si023308m.g I 0.706
Si030811m.g Setaria italica Si030811m.g I 0.707
Si036788m.g Setaria italica Si036788m.g I 0.678
TCM_038105 Theobroma cacao TCM_038105 I 0.741
TCM_041175 Theobroma cacao TCM_041175 I 0.707
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.422
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.644
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.706
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.706
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.678
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.644
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.627
UM06001 Ustilago maydis UM06001 I 0.430
CRC Vitis vinifera VIT_01s0011g00140 I 0.659
INO Vitis vinifera VIT_01s0127g00330 I 0.640
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.644
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.673
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.701
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.741
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.678
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.644
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.644
THITE_22048 Thielavia terrestris THITE_22048 I 0.417
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.678
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.649
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.649
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.593
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.627
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.627
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.627
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.706
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.706
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.706
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.706
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.706
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.706
Ca_06681 Cicer arietinum Ca_06681 I 0.741
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.630
MDP0000192940 Malus domestica MDP0000192940 I 0.678
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.707
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.567
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.706
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.699
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.644
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.644
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.701
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.627
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.627
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.678
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.701
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.678
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.741
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.640
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.567
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.644
MDP0000252640 Malus domestica MDP0000252640 I 0.707
MDP0000263713 Malus domestica MDP0000263713 I 0.602
MDP0000291729 Malus domestica MDP0000291729 I 0.630
MDP0000298333 Malus domestica MDP0000298333 I 0.678
MDP0000331808 Malus domestica MDP0000331808 I 0.707
MDP0000366291 Malus domestica MDP0000366291 I 0.707
MDP0000500810 Malus domestica MDP0000500810 I 0.707
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.678
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.678
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.741
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.707
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.602
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.610
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.644
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.653
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.627
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.678
PK06964.1 Cannabis sativa PK06964.1 I 0.707
PK09461.1 Cannabis sativa PK09461.1 I 0.741
PK13838.1 Cannabis sativa PK13838.1 I 0.659
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.419
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.602
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.582
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.440
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.678
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.627
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.586
XP_002163918.1 Hydra magnipapillata XP_002163918.1 I 0.415
MDOA001488 Musca domestica MDOA001488 I 0.427
Hba_16915 Heterorhabditis bacteriophora Hba_16915 I 0.429
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.427
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.707
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.678
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.699
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.640
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.673
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.678
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.735
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.678
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.678
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.673
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.707
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.596
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.707
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.741
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.630
SBAD_0000070901 Soboliphyme baturini SBAD_0000070901 I 0.425
MDP0000171878 Malus domestica MDP0000171878 I 0.625
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.596
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.741
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.678
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.678
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.707
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.584
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.627
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.440
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.659
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.576
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.737
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.707
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.678
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.707
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.440
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.741
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.707
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.707
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.737
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.707
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.707
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.707
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.630
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.640
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.741
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.707
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.707
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.707
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.707
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.640
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.630
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.659
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.707
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.711
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.741
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.729
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.711
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.678
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.640
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.707
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.707
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.640
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.508
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.584
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.707
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.678
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.659
MDP0000124879 Malus domestica MDP0000124879 I 0.630
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.644
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.564
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.678
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.644
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.741
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.596
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.707
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.672
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.741
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.678
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.741
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.707
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.678
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.695
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.659
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.707
MDP0000126221 Malus domestica MDP0000126221 I 0.602
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.701
GK13574 Drosophila willistoni FBgn0215582 I 0.427
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.659
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.678
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.433
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.644
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.602
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.707
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.640
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.707
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.707
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.741
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.707
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.741
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.644
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.678
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.433
GE25578 Drosophila yakuba FBgn0242642 I 0.427
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.596
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.707
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.630
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.741
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.707
GB50764 Apis mellifera GB50764 I 0.433
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.490
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.489
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.558
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.524
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.437
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.594
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.659
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.640
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.644
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.579
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.620
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.705
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.679
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.627
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.658
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.684
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.627
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.707
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.701
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.627
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.618
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.627
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.701
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.711
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.620
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.620
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.644
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.701
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.678
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.706
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.627
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.627
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.707
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.671
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.706
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.678
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.644
GRMZM5G834758 Zea mays GRMZM5G834758 I 0.433
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.644
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.644
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.638
GH18160 Drosophila grimshawi FBgn0125628 I 0.427
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.445
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.574
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.706
Bo3g037630 Brassica oleracea Bo3g037630 I 0.707
Bo3g041840 Brassica oleracea Bo3g041840 I 0.741
Bo4g195410 Brassica oleracea Bo4g195410 I 0.707
Bo5g009010 Brassica oleracea Bo5g009010 I 0.707
Bo5g039580 Brassica oleracea Bo5g039580 I 0.596
Bo6g073320 Brassica oleracea Bo6g073320 I 0.707
Bo6g108630 Brassica oleracea Bo6g108630 I 0.630
Bo7g056180 Brassica oleracea Bo7g056180 I 0.596
Bo8g055830 Brassica oleracea Bo8g055830 I 0.701
Bo8g112450 Brassica oleracea Bo8g112450 I 0.707
Bo9g001130 Brassica oleracea Bo9g001130 I 0.707
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.456
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.644
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.706
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.513
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.526
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.594
ACEP12759 Atta cephalotes ACEP12759 I 0.420
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.673
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.653
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.707
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.673
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.613
YAB2 Arabidopsis thaliana AT1G08465 I 0.707
YAB3 Arabidopsis thaliana AT4G00180 I 0.707
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.574
BGHDH14_bgh06194 Blumeria graminis BGHDH14_bgh06194 I 0.415
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.627
Bra000378 Brassica rapa Bra000378 I 0.707
Bra000538 Brassica rapa Bra000538 I 0.741
Bra003309 Brassica rapa Bra003309 I 0.707
CapteG224864 Capitella teleta CapteG224864 I 0.416
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
CND03770 Cryptococcus neoformans CND03770 I 0.467
CY34DRAFT_799168 Suillus luteus CY34DRAFT_799168 I 0.427
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.473
E5Q_04235 Mixia osmundae E5Q_04235 I 0.416
E5Q_04236 Mixia osmundae E5Q_04236 I 0.416
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.547
EMIHUDRAFT_117867 Emiliania huxleyi EMIHUDRAFT_117867 I 0.440
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.547
ENSCING00000000505 Ciona intestinalis ENSCING00000000505 I 0.423
F775_25525 Aegilops tauschii F775_25525 I 0.649
F775_27799 Aegilops tauschii F775_27799 I 0.644
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.649
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.706
Bra004364 Brassica rapa Bra004364 I 0.630
Bra012373 Brassica rapa Bra012373 I 0.596
Bra018624 Brassica rapa Bra018624 I 0.707
Bra024599 Brassica rapa Bra024599 I 0.596
Bra030728 Brassica rapa Bra030728 I 0.707
Bra031629 Brassica rapa Bra031629 I 0.707
Bra037320 Brassica rapa Bra037320 I 0.707
Bra040322 Brassica rapa Bra040322 I 0.707
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.706
BRADI1G29730 Brachypodium distachyon BRADI1G29730 I 0.433
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.696
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.627
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.678
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.644
F775_28710 Aegilops tauschii F775_28710 I 0.706
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.701
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.678
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.627
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.706
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.644
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.707
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.678
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.706
YAB4 Oryza sativa OS02G0643200 I 0.678
OS03G0215200 Oryza sativa OS03G0215200 I 0.627
YAB2 Oryza sativa OS03G0650000 I 0.706
YAB5 Oryza sativa OS04G0536300 I 0.644
YAB1 Oryza sativa OS07G0160100 I 0.707
YAB3 Oryza sativa OS10G0508300 I 0.678
YAB6 Oryza sativa OS12G0621100 I 0.706
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.435
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.678
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.706
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.627
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.706
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.644
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.678
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.678
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.627
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.706
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.707
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.678
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.706
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.678
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.627
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.644
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.574
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.435
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.440
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.701
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.650
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.640
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.653
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.678
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.694
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.741
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.678
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.678
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.707
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.741
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.659
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.640
PV09_07652 Verruconis gallopava PV09_07652 I 0.474
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.428
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.621
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.741
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.707
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.707
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.707
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.678
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.659
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.741
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.472
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.437
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.477
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.434
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.678
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.707
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.678
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.678
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.466
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.706
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.627
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.678
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.479
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.472
MCINX012524 Melitaea cinxia MCINX012524 I 0.416
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.644
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.706
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.678
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.706
Moror_16065 Moniliophthora roreri Moror_16065 I 0.522
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.707
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.678
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.707
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.644
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.741
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.618
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.707
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.680
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.644
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.674
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.690
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.516
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.562
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.440
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.467
KGM_20190 Danaus plexippus KGM_20190 I 0.416
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.678
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.627
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.706
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.644
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.602
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.426
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.416
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.706
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.644
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.678
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.706
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.574
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.627
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.706
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.678
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.678
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.627
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.644
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.707
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.574
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.678
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.627
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.678
NV13812 Nasonia vitripennis NV13812 I 0.416
OB02G33040 Oryza brachyantha OB02G33040 I 0.678
OB03G18700 Oryza brachyantha OB03G18700 I 0.627
OB03G35470 Oryza brachyantha OB03G35470 I 0.706
OB04G27010 Oryza brachyantha OB04G27010 I 0.644
OB07G12810 Oryza brachyantha OB07G12810 I 0.707
OB07G25220 Oryza brachyantha OB07G25220 I 0.574
OB12G26050 Oryza brachyantha OB12G26050 I 0.706
OBART02G25670 Oryza barthii OBART02G25670 I 0.678
OBART03G08320 Oryza barthii OBART03G08320 I 0.627
OBART03G27740 Oryza barthii OBART03G27740 I 0.706
OBART04G20010 Oryza barthii OBART04G20010 I 0.644
OBART10G15260 Oryza barthii OBART10G15260 I 0.678
OBART12G19190 Oryza barthii OBART12G19190 I 0.706
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.706