orange1.1g046045m.g (Citrus sinensis)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 orange1.1g046045m.g T334654_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.657 0.868
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.657 0.868
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.640 0.789
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.610 0.789
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.610 0.789
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.540 0.658
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
orange1.1g046045m Sox 82 119

Links

Other Sox family TFs
Other Citrus sinensis TFs

481 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Cla005767 Citrullus lanatus Cla005767 I 0.700
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.696
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.696
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.686
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.686
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.686
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.686
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.686
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.686
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.686
30174.m009083 Ricinus communis 30174.m009083 I 0.686
Ca_12379 Cicer arietinum Ca_12379 I 0.686
TCM_011484 Theobroma cacao TCM_011484 I 0.686
CRC Vitis vinifera VIT_01s0011g00140 I 0.686
Ca_18533 Cicer arietinum Ca_18533 I 0.686
Cla010397 Citrullus lanatus Cla010397 I 0.686
Pm030598 Prunus mume Pm030598 I 0.686
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.686
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.686
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.686
PK13838.1 Cannabis sativa PK13838.1 I 0.686
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.681
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.681
mgf007067m Mimulus guttatus mgf007067m I 0.680
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.679
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.679
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.679
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.675
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.669
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.667
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.667
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.664
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.657
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.657
MDP0000291729 Malus domestica MDP0000291729 I 0.657
CRC Arabidopsis thaliana AT1G69180 D 0.657
Bo6g108630 Brassica oleracea Bo6g108630 I 0.657
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.657
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.657
MDP0000124879 Malus domestica MDP0000124879 I 0.657
Bra004364 Brassica rapa Bra004364 I 0.657
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.657
mgf001016m Mimulus guttatus mgf001016m I 0.655
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.653
OS03G0215200 Oryza sativa OS03G0215200 I 0.653
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.653
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.653
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.653
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.653
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.653
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.653
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.653
OBART03G08320 Oryza barthii OBART03G08320 I 0.653
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.653
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.653
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.653
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.653
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.653
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.653
OB03G18700 Oryza brachyantha OB03G18700 I 0.653
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.653
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.653
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.653
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.653
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.653
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.653
Si037608m.g Setaria italica Si037608m.g I 0.653
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.653
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.653
MDP0000171878 Malus domestica MDP0000171878 I 0.651
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.649
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.647
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.647
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.647
TCM_041175 Theobroma cacao TCM_041175 I 0.647
Bo8g055830 Brassica oleracea Bo8g055830 I 0.646
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.642
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.641
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.640
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.640
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.640
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.640
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.640
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.640
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.640
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.640
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.640
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.640
Bo4g195410 Brassica oleracea Bo4g195410 I 0.640
Cla008752 Citrullus lanatus Cla008752 I 0.640
OB07G12810 Oryza brachyantha OB07G12810 I 0.640
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.640
Pm001547 Prunus mume Pm001547 I 0.640
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.640
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.640
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.640
Bo3g037630 Brassica oleracea Bo3g037630 I 0.640
Bo8g112450 Brassica oleracea Bo8g112450 I 0.640
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.640
Bo5g009010 Brassica oleracea Bo5g009010 I 0.640
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.640
YAB3 Arabidopsis thaliana AT4G00180 I 0.640
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.640
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.640
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.640
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.640
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.640
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.640
mgf009982m Mimulus guttatus mgf009982m I 0.640
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.640
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.640
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.640
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.640
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.640
YAB1 Arabidopsis thaliana AT2G45190 D 0.640
Bo6g073320 Brassica oleracea Bo6g073320 I 0.640
YAB1 Oryza sativa OS07G0160100 I 0.640
AFO Arabidopsis lyrata scaffold_403460.1 I 0.640
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.640
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.640
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.640
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.640
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.640
YAB2 Arabidopsis thaliana AT1G08465 I 0.640
29854.m001136 Ricinus communis 29854.m001136 I 0.640
Si030811m.g Setaria italica Si030811m.g I 0.640
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.640
mgf019496m Mimulus guttatus mgf019496m I 0.640
PK06964.1 Cannabis sativa PK06964.1 I 0.640
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.640
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.640
Ca_07101 Cicer arietinum Ca_07101 I 0.640
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.640
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.640
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.640
MDP0000500810 Malus domestica MDP0000500810 I 0.640
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.640
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.640
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.640
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.640
MDP0000331808 Malus domestica MDP0000331808 I 0.640
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.640
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.640
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.640
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.640
MDP0000252640 Malus domestica MDP0000252640 I 0.640
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.640
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.640
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.640
Bra018624 Brassica rapa Bra018624 I 0.640
Bra003309 Brassica rapa Bra003309 I 0.640
Bra000378 Brassica rapa Bra000378 I 0.640
Bo9g001130 Brassica oleracea Bo9g001130 I 0.640
Bra030728 Brassica rapa Bra030728 I 0.640
Bra031629 Brassica rapa Bra031629 I 0.640
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.640
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.640
Bra040322 Brassica rapa Bra040322 I 0.640
Bra037320 Brassica rapa Bra037320 I 0.640
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.640
MDP0000366291 Malus domestica MDP0000366291 I 0.640
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.640
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.640
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.640
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.640
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.640
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.640
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.640
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.636
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.635
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.634
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.634
YAB6 Oryza sativa OS12G0621100 I 0.634
YAB2 Oryza sativa OS03G0650000 I 0.634
OB12G26050 Oryza brachyantha OB12G26050 I 0.634
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.634
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.634
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.634
Si023308m.g Setaria italica Si023308m.g I 0.634
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.634
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.634
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.634
Si037789m.g Setaria italica Si037789m.g I 0.634
OB03G35470 Oryza brachyantha OB03G35470 I 0.634
F775_28710 Aegilops tauschii F775_28710 I 0.634
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.634
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.634
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.634
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.634
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.634
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.634
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.634
OBART03G27740 Oryza barthii OBART03G27740 I 0.634
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.634
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.634
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.634
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.634
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.634
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.634
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.634
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.634
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.634
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.634
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.634
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.634
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.634
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.634
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.634
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.634
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.634
OBART12G19190 Oryza barthii OBART12G19190 I 0.634
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.634
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.634
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.634
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.634
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.630
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.630
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.630
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.629
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.624
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.623
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.620
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.620
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.617
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.617
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.617
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.616
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.614
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.614
INO Vitis vinifera VIT_01s0127g00330 I 0.613
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.613
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.613
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.611
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.611
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.611
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.611
Ca_25981 Cicer arietinum Ca_25981 I 0.611
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.611
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.611
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.611
MDP0000192940 Malus domestica MDP0000192940 I 0.611
MDP0000298333 Malus domestica MDP0000298333 I 0.611
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.611
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.611
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.611
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.611
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.611
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.611
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.611
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.611
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.611
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.611
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.611
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.611
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.611
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.611
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.611
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.611
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.611
30174.m008839 Ricinus communis 30174.m008839 I 0.611
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.611
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.611
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.611
28200.m000191 Ricinus communis 28200.m000191 I 0.611
Pm017846 Prunus mume Pm017846 I 0.611
Pm023555 Prunus mume Pm023555 I 0.611
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.611
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.611
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.611
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.611
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.611
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.611
mgf015806m Mimulus guttatus mgf015806m I 0.611
mgf003166m Mimulus guttatus mgf003166m I 0.611
mgf011463m Mimulus guttatus mgf011463m I 0.611
Cla011745 Citrullus lanatus Cla011745 I 0.611
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.611
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.611
YAB3 Oryza sativa OS10G0508300 I 0.611
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.611
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.611
YAB5 Oryza sativa OS04G0536300 I 0.611
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.611
OB02G33040 Oryza brachyantha OB02G33040 I 0.611
YAB4 Oryza sativa OS02G0643200 I 0.611
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.611
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.611
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.611
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.611
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.611
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.611
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.611
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.611
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.611
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.611
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.611
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.611
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.611
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.611
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.611
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.611
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.611
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.611
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.611
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.611
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.611
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.611
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.611
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.611
OB04G27010 Oryza brachyantha OB04G27010 I 0.611
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.611
OBART02G25670 Oryza barthii OBART02G25670 I 0.611
OBART10G15260 Oryza barthii OBART10G15260 I 0.611
OBART04G20010 Oryza barthii OBART04G20010 I 0.611
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.611
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.611
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.611
Si018146m.g Setaria italica Si018146m.g I 0.611
Si036788m.g Setaria italica Si036788m.g I 0.611
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.611
Si010859m.g Setaria italica Si010859m.g I 0.611
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.611
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.611
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.611
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.611
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.611
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.611
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.611
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.611
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.611
F775_27799 Aegilops tauschii F775_27799 I 0.611
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.611
F775_25525 Aegilops tauschii F775_25525 I 0.611
TCM_005549 Theobroma cacao TCM_005549 I 0.611
TCM_016030 Theobroma cacao TCM_016030 I 0.611
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.611
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.611
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.611
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.611
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.611
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.611
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.611
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.611
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.611
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.611
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.611
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.611
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.611
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.610
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.610
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.610
MDP0000255415 Malus domestica MDP0000255415 I 0.610
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.610
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.610
Bra000538 Brassica rapa Bra000538 I 0.610
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.610
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.610
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.610
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.610
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.610
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.610
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.610
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.610
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.610
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.610
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.610
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.610
29927.m000626 Ricinus communis 29927.m000626 I 0.610
YAB5 Arabidopsis thaliana AT2G26580 D 0.610
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.610
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.610
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.610
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.610
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.610
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.610
Pm027559 Prunus mume Pm027559 I 0.610
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.610
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.610
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.610
TCM_038105 Theobroma cacao TCM_038105 I 0.610
Ca_06681 Cicer arietinum Ca_06681 I 0.610
PK09461.1 Cannabis sativa PK09461.1 I 0.610
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.610
Cla016962 Citrullus lanatus Cla016962 I 0.610
Cla012424 Citrullus lanatus Cla012424 I 0.610
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.610
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.610
mgf015972m Mimulus guttatus mgf015972m I 0.610
Bo3g041840 Brassica oleracea Bo3g041840 I 0.610
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.610
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.610
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.610
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.610
mgf010765m Mimulus guttatus mgf010765m I 0.610
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.605
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.604
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.604
TCM_031868 Theobroma cacao TCM_031868 I 0.604
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.602
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.600
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.587
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.584
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.584
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.584
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.584
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.584
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.584
Pm006709 Prunus mume Pm006709 I 0.584
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.584
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.584
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.584
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.584
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.576
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.576
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.576
MDP0000126221 Malus domestica MDP0000126221 I 0.576
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.576
MDP0000263713 Malus domestica MDP0000263713 I 0.576
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.569
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.562
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.562
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.562
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.560
Ca_21472 Cicer arietinum Ca_21472 I 0.547
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.546
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.546
Cla000824 Citrullus lanatus Cla000824 I 0.546
Bra012373 Brassica rapa Bra012373 I 0.540
Bra024599 Brassica rapa Bra024599 I 0.540
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.540
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.540
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.540
Bo7g056180 Brassica oleracea Bo7g056180 I 0.540
Bo5g039580 Brassica oleracea Bo5g039580 I 0.540
INO Arabidopsis thaliana AT1G23420 D 0.540
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.540
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.540
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.524
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.518
OB07G25220 Oryza brachyantha OB07G25220 I 0.518
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.518
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.518
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.518
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.516
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.514
mgf023167m Mimulus guttatus mgf023167m I 0.514
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.512
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.512
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.512
Cla010239 Citrullus lanatus Cla010239 I 0.511
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.511
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.510
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.505
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.500
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.491
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.491
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.482
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.477
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.472
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.466
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.466
29631.m001046 Ricinus communis 29631.m001046 I 0.465
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.464
H101_08199 Trichophyton interdigitale H101_08199 N 0.462
23225_YPR052C Saccharomyces paradoxus 23225_YPR052C I 0.462
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.460
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.460
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.458
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.454
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.453
0600010013 Ostreococcus tauri 0600010013 I 0.444
Moror_16065 Moniliophthora roreri Moror_16065 I 0.439
e_gw1.88.21.1 Fragilariopsis cylindrus e_gw1.88.21.1 N 0.430
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.425
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.425
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.423
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.422
Minc04648 Meloidogyne incognita Minc04648 N 0.420
Minc03634 Meloidogyne incognita Minc03634 N 0.420
PEQ_0000212901 Parascaris equorum PEQ_0000212901 N 0.418
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.416